PyRanges objects
The main object in pyranges1 is the PyRanges object. It is a pandas DataFrame with additional methods for genomic operations.
- class pyranges1.core.pyranges_main.PyRanges(*args, **kwargs)
Two-dimensional representation of genomic intervals and their annotations.
A PyRanges object must have the columns Chromosome, Start and End. A Strand column is optional and adds strand information to the intervals. Any other columns are allowed and are considered metadata.
You can initialize a PyRanges object like you would a pandas DataFrame, as long as the resulting DataFrame has the necessary columns (Chromosome, Start, End; Strand is optional). See examples below, and https://pandas.pydata.org/docs/reference/api/pandas.DataFrame.html for more information.
- Parameters:
data (dict, pd.DataFrame, or None, default None)
index (Index or array-like)
columns (Index or array-like)
dtype (type, default None)
copy (bool or None, default None)
See also
pyranges.read_bedread bed-file into PyRanges
pyranges.read_bamread bam-file into PyRanges
pyranges.read_gffread gff-file into PyRanges
pyranges.read_gtfread gtf-file into PyRanges
Examples
>>> pr.PyRanges() index | Chromosome Start End int64 | float64 float64 float64 ------- --- ------------ --------- --------- PyRanges with 0 rows, 3 columns, and 1 index columns. Contains 0 chromosomes.
You can initiatize PyRanges with a DataFrame:
>>> df = pd.DataFrame({"Chromosome": ["chr1", "chr2"], "Start": [100, 200], ... "End": [150, 201]}) >>> df Chromosome Start End 0 chr1 100 150 1 chr2 200 201 >>> pr.PyRanges(df) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 100 150 1 | chr2 200 201 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
Or you can use a dictionary of iterables:
>>> gr = pr.PyRanges({"Chromosome": [1, 1], "Strand": ["+", "-"], "Start": [1, 4], "End": [2, 27], ... "TP": [0, 1], "FP": [12, 11], "TN": [10, 9], "FN": [2, 3]}) >>> gr index | Chromosome Strand Start End TP FP TN FN int64 | int64 str int64 int64 int64 int64 int64 int64 ------- --- ------------ -------- ------- ------- ------- ------- ------- ------- 0 | 1 + 1 2 0 12 10 2 1 | 1 - 4 27 1 11 9 3 PyRanges with 2 rows, 8 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Operations that remove a column required for a PyRanges return a DataFrame instead:
>>> gr.drop("Chromosome", axis=1) Strand Start End TP FP TN FN 0 + 1 2 0 12 10 2 1 - 4 27 1 11 9 3
>>> pr.PyRanges(dict(Chromosome=["chr1", "chr2"], Start=[1, 2], End=[2, 3])) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 1 2 1 | chr2 2 3 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
- property chromosomes: list[str]
Return the list of unique chromosomes in this PyRanges, in natsorted order (e.g. chr2 < chr11).
- property chromosomes_and_strands: list[tuple[str, str]]
Return the list of unique (chromosome, strand) pairs in this PyRanges in natsorted order (e.g. chr2 < chr11).
Examples
>>> gr = pr.PyRanges({"Chromosome": [1, 2, 2, 3], "Start": [1, 2, 3, 9], "End": [3, 3, 10, 12], "Strand": ["+", "-", "+", "-"]}) >>> gr.chromosomes_and_strands [(1, '+'), (2, '+'), (2, '-'), (3, '-')] >>> gr.remove_strand().chromosomes_and_strands Traceback (most recent call last): ... ValueError: PyRanges has no strand column.
- clip_ranges(chromsizes: dict[str | int, int] | PyRanges | None = None, *, remove: bool = False, only_right: bool = False) PyRanges
Clip or remove intervals outside of sequence (e.g. Chromosome) bounds.
- Parameters:
chromsizes (dict or PyRanges or pyfaidx.Fasta or None, default None) – Dict or PyRanges describing the lengths of the sequences (the “Chromosomes” in the self object). pyfaidx.Fasta object is also accepted since it conveniently loads chromosome length. If None, clipping is only on the left, i.e. for the portions of intervals that are negative (Start < 0).
remove (bool, default False) – Drops intervals entirely if they are even partially out of bounds, instead of clipping them
only_right (bool, default False) – If True, remove or clip only intervals that are out-of-bounds on the right, and do not alter those out-of-bounds on the left (whose Start is < 0)
Examples
>>> import pyranges1 as pr >>> d = {"Chromosome": [1, 1, 3], "Start": [1, 249250600, 5], "End": [2, 249250640, 7]} >>> gr = pr.PyRanges(d) >>> gr index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ --------- --------- 0 | 1 1 2 1 | 1 249250600 249250640 2 | 3 5 7 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
>>> chromsizes = {1: 249250621, 3: 500} >>> chromsizes {1: 249250621, 3: 500}
>>> gr.clip_ranges(chromsizes) index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ --------- --------- 0 | 1 1 2 1 | 1 249250600 249250621 2 | 3 5 7 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr.clip_ranges(chromsizes, remove=True) index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 1 2 2 | 3 5 7 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
>>> del chromsizes[3] >>> chromsizes {1: 249250621}
>>> gr.clip_ranges(chromsizes) Traceback (most recent call last): ... ValueError: Not all chromosomes were in the chromsize dict. Missing keys: {3}.
>>> w = pr.PyRanges({"Chromosome": [1, 1, 1], "Start": [-10, 249250600, 100], "End": [2, 249250640, 150]}) >>> w index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ --------- --------- 0 | 1 -10 2 1 | 1 249250600 249250640 2 | 1 100 150 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes. Invalid ranges: * 1 starts or ends are < 0. See indexes: 0
>>> w.clip_ranges() index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ --------- --------- 0 | 1 0 2 1 | 1 249250600 249250640 2 | 1 100 150 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> w.clip_ranges({1:249250620}, only_right=True) index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ --------- --------- 0 | 1 -10 2 1 | 1 249250600 249250620 2 | 1 100 150 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes. Invalid ranges: * 1 starts or ends are < 0. See indexes: 0
- cluster_overlaps(use_strand: Literal['auto'] | bool = 'auto', *, match_by: str | Iterable[str] | None = None, slack: int = 0, cluster_column: str = 'Cluster') PyRanges
Give overlapping intervals a common id.
- Parameters:
use_strand ({"auto", True, False}, default: "auto") – Whether to cluster only intervals on the same strand. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.
slack (int, default 0) – Length by which the criteria of overlap are loosened. A value of 1 clusters also bookended intervals. Higher slack values cluster more distant intervals (with a maximum distance of slack-1 between them).
cluster_column – Name the cluster column added in output. Default: “Cluster”
- Returns:
PyRanges with an ID-column “Cluster” added.
- Return type:
See also
PyRanges.mergecombine overlapping intervals into one
Examples
>>> gr = pr.PyRanges(dict(Chromosome=1, Start=[5, 6, 12, 16, 20, 22, 24], End=[9, 8, 16, 18, 23, 25, 27])) >>> gr index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 5 9 1 | 1 6 8 2 | 1 12 16 3 | 1 16 18 4 | 1 20 23 5 | 1 22 25 6 | 1 24 27 PyRanges with 7 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.cluster_overlaps() index | Chromosome Start End Cluster int64 | int64 int64 int64 uint32 ------- --- ------------ ------- ------- --------- 0 | 1 5 9 0 1 | 1 6 8 0 2 | 1 12 16 1 3 | 1 16 18 2 4 | 1 20 23 3 5 | 1 22 25 3 6 | 1 24 27 3 PyRanges with 7 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
Slack=1 will cluster also bookended intervals:
>>> gr.cluster_overlaps(slack=1) index | Chromosome Start End Cluster int64 | int64 int64 int64 uint32 ------- --- ------------ ------- ------- --------- 0 | 1 5 9 0 1 | 1 6 8 0 2 | 1 12 16 1 3 | 1 16 18 1 4 | 1 20 23 2 5 | 1 22 25 2 6 | 1 24 27 2 PyRanges with 7 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
Higher values of slack will cluster more distant intervals:
>>> gr.cluster_overlaps(slack=3) index | Chromosome Start End Cluster int64 | int64 int64 int64 uint32 ------- --- ------------ ------- ------- --------- 0 | 1 5 9 0 1 | 1 6 8 0 2 | 1 12 16 1 3 | 1 16 18 1 4 | 1 20 23 1 5 | 1 22 25 1 6 | 1 24 27 1 PyRanges with 7 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
- combine_interval_columns(function: Literal['intersect', 'union', 'swap'] | CombineIntervalColumnsOperation = 'intersect', *, start: str = 'Start', end: str = 'End', start2: str = 'Start_b', end2: str = 'End_b', drop_old_columns: bool = True) PyRanges
Use two pairs of columns representing intervals to create a new start and end column.
The function is designed as post-processing after join_overlaps to aggregate the coordinates of the two intervals. By default, the new start and end columns will be the intersection of the intervals.
- Parameters:
function ({"intersect", "union", "swap"} or Callable, default "intersect") – How to combine the self and other intervals: “intersect”, “union”, or “swap” If a callable is passed, it should take four Series arguments: start1, end1, start2, end2; and return a tuple of two integers: (new_starts, new_ends).
start (str, default "Start") – Column name for Start of first interval
end (str, default "End") – Column name for End of first interval
start2 (str, default "Start_b") – Column name for Start of second interval
end2 (str, default "End_b") – Column name for End of second interval
drop_old_columns (bool, default True) – Whether to drop the above mentioned columns.
Examples
>>> gr1 = pr.example_data.aorta.head(3).remove_nonloc_columns() >>> gr1 index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9916 10115 - 1 | chr1 9939 10138 + 2 | chr1 9951 10150 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr2 = pr.example_data.aorta2.head(3).remove_nonloc_columns() >>> gr2 index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9988 10187 - 1 | chr1 10073 10272 + 2 | chr1 10079 10278 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> j = gr1.join_overlaps(gr2) >>> j index | Chromosome Start End Strand Start_b End_b int64 | category int64 int64 category int64 int64 ------- --- ------------ ------- ------- ---------- --------- ------- 0 | chr1 9916 10115 - 9988 10187 0 | chr1 9916 10115 - 10079 10278 1 | chr1 9939 10138 + 10073 10272 2 | chr1 9951 10150 - 9988 10187 2 | chr1 9951 10150 - 10079 10278 PyRanges with 5 rows, 6 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
Combine the interval coordinates in different ways:
>>> j.combine_interval_columns() # default: "intersect" index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9988 10115 - 0 | chr1 10079 10115 - 1 | chr1 10073 10138 + 2 | chr1 9988 10150 - 2 | chr1 10079 10150 - PyRanges with 5 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
>>> j.combine_interval_columns("union") index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9916 10187 - 0 | chr1 9916 10278 - 1 | chr1 9939 10272 + 2 | chr1 9951 10187 - 2 | chr1 9951 10278 - PyRanges with 5 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
>>> j.combine_interval_columns("swap") index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9988 10187 - 0 | chr1 10079 10278 - 1 | chr1 10073 10272 + 2 | chr1 9988 10187 - 2 | chr1 10079 10278 - PyRanges with 5 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
>>> def custom_combine(s1, e1, s2, e2): # keep Start from first, End from second ... return (s1, e2) >>> j.combine_interval_columns(custom_combine) index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 9916 10187 - 0 | chr1 9916 10278 - 1 | chr1 9939 10272 + 2 | chr1 9951 10187 - 2 | chr1 9951 10278 - PyRanges with 5 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
- complement_ranges(group_by: str | Iterable[str] | None = None, *, use_strand: Literal['auto'] | bool = 'auto', include_first_interval: bool = False, group_sizes_col: str = 'Chromosome', chromsizes: dict[str | int, int] | None = None) PyRanges
Return the internal complement of the intervals, i.e. its introns.
The complement of an interval is the set of intervals that are not covered by the original interval. This function is useful for obtaining the introns of a set of exons, corresponding to the “internal” complement, i.e. excluding the first and last portion of each chromosome not covered by intervals.
- Parameters:
group_by (str or list, optional) – Column(s) to group intervals (e.g. exons into transcripts). If provided, the complement will be calculated separately for each group.
use_strand ({"auto", True, False}, default "auto") – Whether to return complement intervals separately for those on the positive and negative strands. The default “auto” means that strand information is used if present and valid (see .strand_valid).
include_first_interval (bool, default False) – If True, include the external complement interval at the beginning of the chromosome (or group), i.e. the interval from the start of the chromosome up to the first interval.
group_sizes_col (str, default CHROM_COL) – The column name used to match keys in the
chromsizesmapping. This determines the total size of each chromosome (or group) when calculating external complement intervals.chromsizes (dict[str | int, int] or None, optional) – If provided, external complement intervals will also be returned, i.e. the intervals corresponding to the beginning of the chromosome up to the first interval and from the last interval to the end of the chromosome. The dictionary should map chromosome (or group) identifiers to their total sizes. A PyRanges or pyfaidx.Fasta object is also accepted since it conveniently loads chromosome lengths.
Notes
To ensure non-overlap among the input intervals, merge_overlaps is run before the complement is calculated.
Bookended intervals will result in no complement intervals returned since they would be of length 0.
See also
PyRanges.subtract_overlapsreport non-overlapping subintervals
PyRanges.outer_rangesreport the boundaries of groups of intervals (e.g. transcripts/genes)
Examples
>>> a = pr.PyRanges(dict(Chromosome="chr1", Start=[2, 10, 20, 40], End=[5, 18, 30, 46], ID=['a', 'a', 'b', 'b'])) >>> a index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 2 5 a 1 | chr1 10 18 a 2 | chr1 20 30 b 3 | chr1 40 46 b PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> a.complement_ranges('ID', group_sizes_col="ID", chromsizes={"a": 22, "b": 100}, include_first_interval=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 0 2 a 1 | chr1 5 10 a 2 | chr1 18 22 a 3 | chr1 0 20 b 4 | chr1 30 40 b 5 | chr1 46 100 b PyRanges with 6 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
Get complement of the whole set of intervals, without grouping:
Using complement to get introns:
>>> a.complement_ranges('ID') index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 5 10 a 1 | chr1 30 40 b PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> a.complement_ranges() index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 5 10 1 | chr1 18 20 2 | chr1 30 40 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
Include external intervals:
>>> a.complement_ranges(chromsizes={'chr1': 10000}, include_first_interval=True) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 0 2 1 | chr1 5 10 2 | chr1 18 20 3 | chr1 30 40 4 | chr1 46 10000 PyRanges with 5 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> a.complement_ranges('ID', chromsizes={'chr1': 10000}, include_first_interval=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 0 2 a 1 | chr1 5 10 a 2 | chr1 18 10000 a 3 | chr1 0 20 b 4 | chr1 30 40 b 5 | chr1 46 10000 b PyRanges with 6 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
For complement of whole sets of intervals, you can explicitly use_strand or not:
>>> b = pr.PyRanges(dict(Chromosome="chr1", Start=[1, 10, 20, 40], End=[5, 18, 30, 46], ... Strand=['+', '+', '-', '-'])) >>> b index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 + 1 | chr1 10 18 + 2 | chr1 20 30 - 3 | chr1 40 46 - PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> b.complement_ranges(use_strand=True) # same as b.complement_ranges() because b.strand_valid == True index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 5 10 + 1 | chr1 30 40 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> b.complement_ranges(use_strand=False) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 5 10 1 | chr1 18 20 2 | chr1 30 40 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> b.complement_ranges(use_strand=False, chromsizes={'chr1': 10000}, include_first_interval=True) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 0 1 1 | chr1 5 10 2 | chr1 18 20 3 | chr1 30 40 4 | chr1 46 10000 PyRanges with 5 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
Bookended intervals (indices 0-1 below) and overlapping intervals (2-3) won’t return any in-between intervals:
>>> c = pr.PyRanges(dict(Chromosome="chr1", Start=[1, 5, 8, 10], End=[5, 7, 14, 16])) >>> c.complement_ranges() index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 7 8 PyRanges with 1 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
- compute_interval_metrics(metrics: str | Iterable[str] | Mapping[str, str] = 'fraction', *, start: str = 'Start', end: str = 'End', start2: str = 'Start_b', end2: str = 'End_b', denom: str = 'first') PyRanges
Attach interval-relationship metrics as new columns.
- Parameters:
metrics –
- One of the following forms:
single string, eg “length”
iterable of strings, eg [“fraction”, “jaccard”]
mapping {metric_name -> new_column_name} to rename on the fly
Accepted metric names are listed in VALID_METRICS.
denom ({"first", "second", "union"}, default "first") – Denominator for the fraction metric. Must be “first”, “second” or “union”.
start (str, default START_COL / END_COL) – Column names holding the first interval coordinates.
end (str, default START_COL / END_COL) – Column names holding the first interval coordinates.
start2 (str, default START_COL + "_b" / END_COL + "_b") – Column names holding the second interval coordinates.
end2 (str, default START_COL + "_b" / END_COL + "_b") – Column names holding the second interval coordinates.
denom – Denominator used by the fraction metric.
- Returns:
RangeFrame – Copy of self with extra metric columns.
Metrics
——-
overlap_length – Raw number of overlapping bases.
fraction – Overlap divided by a denominator chosen with denom (“first”, “second”, or “union”).
jaccard – Overlap divided by the union length of the two intervals.
distance – Positive gap in bases when intervals do not touch; 0 when they overlap or abut.
overlap – Boolean flag - True if at least one base overlaps.
signed_distance – Same as distance but signed: negative when the second interval is upstream of the first, positive when downstream, 0 when touching/overlapping.
midpoint_distance – Absolute distance between interval midpoints.
symmetric_coverage – 2 * overlap ÷ (length1 + length2). Ranges from 0 to 1.
relative_direction – For frames that contain “Strand” and “Strand_b”: “same” if strands match, “opposite” if they differ, “unknown” if either strand is “.” or missing.
Examples
>>> import pyranges1 as pr >>> df = pd.DataFrame( ... { ... "Chromosome": ["chr1"] * 5, ... "Start": [2, 10, 20, 40, 80], ... "End": [8, 12, 25, 45, 85], ... "Strand": ["+", "-", "+", "+", "-"], ... "Start_b": [5, 9, 23, 60, 70], ... "End_b": [7, 20, 30, 70, 75], ... "Strand_b": ["+", "+", "-", "-", "+"], ... } ... ) >>> gr = pr.PyRanges(df)
# length >>> gr.compute_interval_metrics(“overlap_length”)[“overlap_length”].tolist() [2, 2, 2, 0, 0]
# fraction (overlap / first interval length) >>> gr.compute_interval_metrics(“fraction”)[“fraction”].round(2).tolist() [0.33, 1.0, 0.4, 0.0, 0.0]
# jaccard >>> gr.compute_interval_metrics(“jaccard”)[“jaccard”].round(2).tolist() [0.33, 0.18, 0.2, 0.0, 0.0]
# distance (unsigned gap; 0 when overlapping) >>> gr.compute_interval_metrics(“distance”)[“distance”].tolist() [0, 0, 0, 15, 5]
# overlap flag >>> gr.compute_interval_metrics(“overlap”)[“overlap”].tolist() [True, True, True, False, False]
# signed_distance >>> gr.compute_interval_metrics(“signed_distance”)[“signed_distance”].tolist() [0, 0, 0, 15, -5]
# midpoint_distance >>> gr.compute_interval_metrics(“midpoint_distance”)[“midpoint_distance”].tolist() [1.0, 3.5, 4.0, 22.5, 10.0]
# symmetric_coverage >>> gr.compute_interval_metrics(“symmetric_coverage”)[“symmetric_coverage”].round(2).tolist() [0.5, 0.31, 0.33, 0.0, 0.0]
# relative_direction (requires strand columns) >>> gr.compute_interval_metrics(“relative_direction”)[“relative_direction”].tolist() [‘same’, ‘opposite’, ‘opposite’, ‘opposite’, ‘opposite’]
- count_overlaps(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', *, match_by: str | list[str] | None = None, slack: int = 0, overlap_col: str = 'Count') PyRanges
Count number of overlaps per interval.
For each interval in self, report how many intervals in ‘other’ overlap with it.
- Parameters:
other (PyRanges) – Count overlaps with this PyRanges.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
slack (int, default 0) – Temporarily lengthen intervals in self before searching for overlaps.
overlap_col (str, default "Count") – Name of column with overlap counts.
- Returns:
PyRanges with a column of overlaps added.
- Return type:
See also
pyranges.count_overlapscount overlaps from multiple PyRanges
Examples
>>> f1 = pr.example_data.f1.remove_nonloc_columns() >>> f1 index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 3 6 + 1 | chr1 5 7 - 2 | chr1 8 9 + PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f2 = pr.example_data.f2.remove_nonloc_columns() >>> f2 index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 1 2 + 1 | chr1 6 7 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f1.count_overlaps(f2) index | Chromosome Start End Strand Count int64 | category int64 int64 category uint32 ------- --- ------------ ------- ------- ---------- -------- 0 | chr1 3 6 + 0 1 | chr1 5 7 - 1 2 | chr1 8 9 + 0 PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f1.count_overlaps(f2, slack=1, strand_behavior="ignore") index | Chromosome Start End Strand Count int64 | category int64 int64 category uint32 ------- --- ------------ ------- ------- ---------- -------- 0 | chr1 3 6 + 1 1 | chr1 5 7 - 1 2 | chr1 8 9 + 0 PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> annotation = pr.example_data.ensembl_gtf.get_with_loc_columns(['transcript_id', 'Feature']) >>> reads = pr.random(1000, chromsizes={'1':150000}, strand=False, seed=123) >>> annotation.count_overlaps(reads, overlap_col="NumberOverlaps") index | Chromosome Start End Strand transcript_id Feature NumberOverlaps int64 | category int64 int64 category str category uint32 ------- --- ------------ ------- ------- ---------- --------------- ---------- ---------------- 0 | 1 11868 14409 + nan gene 17 1 | 1 11868 14409 + ENST00000456328 transcript 17 2 | 1 11868 12227 + ENST00000456328 exon 3 3 | 1 12612 12721 + ENST00000456328 exon 1 ... | ... ... ... ... ... ... ... 7 | 1 120724 133723 - ENST00000610542 transcript 76 8 | 1 133373 133723 - ENST00000610542 exon 1 9 | 1 129054 129223 - ENST00000610542 exon 3 10 | 1 120873 120932 - ENST00000610542 exon 1 PyRanges with 11 rows, 7 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- downstream(length: int, gap: int = 0, *, group_by: str | Iterable[str] | None = None, use_strand: Literal['auto'] | bool = 'auto') PyRanges
Return regions downstream (at the 5’ side) of input intervals.
- Parameters:
length (int) – Size of the region (bp), > 0.
gap (int, default 0) – Distance between input intervals and region; use negative to include some overlap.
group_by (str or list of str or None) – Name(s) of column(s) to group intervals. If provided, one region per group (e.g. transcript) is returned.
use_strand ({"auto", True, False}, default: "auto") – Whether to consider strand; if so, the downstream window of negative intervals is on their left. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
See also
PyRanges.slice_rangesobtain subsequences of intervals, providing transcript-level coordinates
PyRanges.upstreamreturn regions upstream of input intervals or transcripts
PyRanges.three_endreturn the 3’ end of intervals or transcripts
PyRanges.extend_rangesreturn intervals or transcripts extended at one or both ends
Examples
>>> a = pr.PyRanges({'Chromosome':['chr1','chr1'], ... 'Start':[100,200],'End':[120,220], ... 'Strand':['+','-']}) >>> a index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 100 120 + 1 | chr1 200 220 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Default 10-bp window butt-ended to the feature:
>>> a.downstream(10) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 120 130 + 1 | chr1 190 200 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
With a 5-bp gap:
>>> a.downstream(10, gap=5) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 125 135 + 1 | chr1 185 195 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
With a 5-bp overlap:
>>> a.downstream(10, gap=-5) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 115 125 + 1 | chr1 195 205 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Transcript-aware (two 2-exon transcripts):
>>> ex = pr.PyRanges({'Chromosome':['chr1']*4, ... 'Start':[0,10,30,50],'End':[5,15,40,60], ... 'Strand':['+','+','-','-'], ... 'Tx':['tx1','tx1','tx2','tx2']}) >>> ex index | Chromosome Start End Strand Tx int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 0 | chr1 0 5 + tx1 1 | chr1 10 15 + tx1 2 | chr1 30 40 - tx2 3 | chr1 50 60 - tx2 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> ex.downstream(5, group_by='Tx') index | Chromosome Start End Strand Tx int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 1 | chr1 15 20 + tx1 2 | chr1 25 30 - tx2 PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Note that upstream regions may extend beyond the start of the chromosome, resulting in invalid ranges. See clip_ranges() to fix this.
>>> ex.downstream(50, group_by='Tx') index | Chromosome Start End Strand Tx int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 1 | chr1 15 65 + tx1 2 | chr1 -20 30 - tx2 PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands. Invalid ranges: * 1 starts or ends are < 0. See indexes: 2
- extend_ranges(ext: int | None = None, ext_5: int | None = None, ext_3: int | None = None, group_by: str | Iterable[str] | None = None, use_strand: Literal['auto'] | bool = 'auto') PyRanges
Extend the intervals from the 5’ and/or 3’ ends.
The Strand (if valid) is considered when extending the intervals: a 5’ extension applies to the Start of a “+” strand interval and to the End of a “-” strand interval.
- Parameters:
ext (int or None) – Extend intervals by this amount from both ends.
ext_5 (int or None) – Extend intervals by this amount from the 5’ end.
ext_3 (int or None) – Extend intervals by this amount from the 3’ end.
group_by (str or list of str, default: None) – group intervals by these column name(s) (e.g. into multi-exon transcripts), so that the extension is applied only to the left-most and/or right-most interval.
use_strand ({"auto", True, False}, default: "auto") – If False, ignore strand information when extending intervals. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
See also
PyRanges.slice_rangesobtain subsequences of intervals, providing transcript-level coordinates
PyRanges.upstreamreturn regions upstream of input intervals or transcripts
PyRanges.downstreamreturn regions downstream of input intervals or transcripts
PyRanges.five_endreturn the 5’ end of intervals or transcripts
PyRanges.three_endreturn the 3’ end of intervals or transcripts
PyRanges.extend_rangesreturn intervals or transcripts extended at one or both ends
Examples
>>> d = {'Chromosome': ['chr1', 'chr1', 'chr1'], 'Start': [3, 8, 5], 'End': [6, 9, 7], ... 'Strand': ['+', '+', '-']} >>> gr = pr.PyRanges(d) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 3 6 + 1 | chr1 8 9 + 2 | chr1 5 7 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.extend_ranges(3) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 0 9 + 1 | chr1 5 12 + 2 | chr1 2 10 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.extend_ranges(ext_3=1, ext_5=2) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 7 + 1 | chr1 6 10 + 2 | chr1 4 9 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.extend_ranges(ext_3=1, ext_5=2, use_strand=False) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 7 + 1 | chr1 6 10 + 2 | chr1 3 8 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Extending by negative values will contract the intervals. This may yield invalid intervals:
>>> gr.extend_ranges(-1) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 4 5 + 1 | chr1 9 8 + 2 | chr1 6 6 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands. Invalid ranges: * 2 intervals are empty or negative length (end <= start). See indexes: 1, 2
Extending beyond the boundaries of the chromosome is allowed though it yields invalid ranges (below). See clip_ranges() to fix this.
>>> gr.extend_ranges(4) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 -1 10 + 1 | chr1 4 13 + 2 | chr1 1 11 - PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands. Invalid ranges: * 1 starts or ends are < 0. See indexes: 0
>>> gr['transcript_id']=['a', 'a', 'b'] >>> gr.extend_ranges(group_by='transcript_id', ext_3=3) index | Chromosome Start End Strand transcript_id int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- --------------- 0 | chr1 3 6 + a 1 | chr1 8 12 + a 2 | chr1 2 7 - b PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- five_end(group_by: str | Iterable[str] | None = None, ext: int = 0) PyRanges
Return the five prime end of intervals.
The five prime end is the start of a forward strand or the end of a reverse strand. All returned intervals have length of 1.
- Parameters:
group_by (str or list of str, default: None) – Optional column name(s). If provided, the five prime end is calculated for each group of intervals.
ext (int, default 0) – Lengthen the resulting intervals on both ends by this amount.
See also
PyRanges.upstreamreturn regions upstream of input intervals or transcripts
PyRanges.three_endreturn the 3’ end of intervals or transcripts
PyRanges.extend_rangesreturn intervals or transcripts extended at one or both ends
- Returns:
PyRanges with the five prime ends
- Return type:
Note
Requires the PyRanges to be stranded.
See also
PyRanges.three_endreturn the 3’ end
PyRanges.slice_rangesreturn subintervals specified in relative mRNA-based coordinates
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1', 'chr1'], 'Start': [3, 10, 5], 'End': [9, 14, 7], ... 'Strand': ["+", "+", "-"], 'Name': ['a', 'a', 'b']}) >>> gr index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 3 9 + a 1 | chr1 10 14 + a 2 | chr1 5 7 - b PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.five_end() index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 3 4 + a 1 | chr1 10 11 + a 2 | chr1 6 7 - b PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.five_end(group_by='Name') index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 3 4 + a 2 | chr1 6 7 - b PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.five_end(group_by='Name', ext=1) index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 2 5 + a 2 | chr1 5 8 - b PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- flip_strand() PyRanges
Flip the strand of every interval (+ → - and - → +).
All other columns remain unchanged. If the object does not contain a valid Strand column (see .strand_valid) a ValueError is raised.
- Returns:
A new PyRanges whose Strand column is flipped.
- Return type:
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], ... 'Start': [0, 10], 'End': [5, 15], ... 'Strand': ['+', '-']}) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 0 5 + 1 | chr1 10 15 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.flip_strand() index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 0 5 - 1 | chr1 10 15 + PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Attempting to flip when strands are missing or invalid:
>>> pr.PyRanges({'Chromosome': ['chr1'], 'Start': [0], 'End': [5]}).flip_strand() Traceback (most recent call last): ... ValueError: strand column is missing or invalid
- get_sequence(path: Path | None = None, *, pyfaidx_fasta: pyfaidx.Fasta | None = None, use_strand: Literal['auto'] | bool = 'auto', group_by: str | Iterable[str] | None = None, sequence_column: str = 'Sequence') Series
Get the sequence of the intervals from a fasta file.
- Parameters:
path (Path) – Path to fasta file. It will be indexed using pyfaidx if an index is not found
pyfaidx_fasta (pyfaidx.Fasta) – Alternative method to provide fasta target, as a pyfaidx.Fasta object
use_strand ({"auto", True, False}, default: "auto") – If True, intervals on the reverse strand will be reverse complemented. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
- group_bystr or list of str, optional
If provided, intervals grouped by this/these ID column(s) and the corresponding sequences are concatenated 5’->3’. This is useful for obtaining the full sequences of multi-exon transcripts.
- sequence_column: str, default “Sequence”
What the added column will be called.
- Returns:
Sequences, one per interval, with the same index as self. If group_by is provided, instead returns one sequence per group, with the index being the group ID(s).
- Return type:
Note
This function requires the library pyfaidx, it can be installed with
conda install -c bioconda pyfaidxorpip install pyfaidx.Sorting the PyRanges is likely to improve the speed. Intervals on the negative strand will be reverse complemented.
Warning
Note that the names in the fasta header and self.Chromosome must be the same.
See also
pyranges.seqssubmodule with sequence-related functions
Examples
>>> import pyranges1 as pr >>> r = pr.PyRanges({"Chromosome": ["chr1", "chr1"], ... "Start": [5, 0], "End": [8, 5], ... "Strand": ["+", "-"]})
>>> r index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 5 8 + 1 | chr1 0 5 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> tmp_handle = open("temp.fasta", "w+") >>> _ = tmp_handle.write(">chr1\n") >>> _ = tmp_handle.write("GTAATCAT\n") >>> tmp_handle.close()
>>> seq = r.get_sequence("temp.fasta", sequence_column="Sequence") >>> seq 0 CAT 1 ATTAC Name: Sequence, dtype: object
>>> r["seq"] = seq >>> r index | Chromosome Start End Strand seq int64 | str int64 int64 str object ------- --- ------------ ------- ------- -------- -------- 0 | chr1 5 8 + CAT 1 | chr1 0 5 - ATTAC PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> r.get_sequence("temp.fasta", use_strand=False) 0 CAT 1 GTAAT Name: Sequence, dtype: object
Fetching full sequences of transcripts:
>>> gr = pr.PyRanges({"Chromosome": ['chr1'] * 5, ... "Start": [0, 9, 18, 9, 18], "End": [4, 13, 21, 13, 21], ... "Strand":['+', '-', '-', '-', '-'], ... "transcript": ['t1', 't2', 't2', 't4', 't5']})
>>> tmp_handle = open("temp.fasta", "w+") >>> _ = tmp_handle.write(">chr1\n") >>> _ = tmp_handle.write("AAACCCTTTGGGAAACCCTTTGGG\n") >>> tmp_handle.close()
>>> seq = gr.get_sequence(path="temp.fasta", group_by='transcript') >>> seq transcript t1 AAAC t2 AAATCCC t4 TCCC t5 AAA Name: Sequence, dtype: object
With use_strand=False, all intervals are treated as if on the forward strand:
>>> seq2 = gr.get_sequence(path="temp.fasta", group_by='transcript', use_strand=False, sequence_column="Seq2") >>> seq2 transcript t1 AAAC t2 GGGATTT t4 GGGA t5 TTT Name: Seq2, dtype: object
To write to a file in fasta format: >>> with open(‘outfile.fasta’, ‘w’) as fw: … nchars=60 … for oneid, oneseq in seq.items(): … s = ‘\n’.join([ oneseq[i:i+nchars] for i in range(0, len(oneseq), nchars)]) … _bytes_written = fw.write(f’>{oneid}\n{s}\n’)
- get_with_loc_columns(key: str | Iterable[str], *, preserve_loc_order: bool = False) PyRanges
Return a PyRanges with the requested columns, as well as the genome location columns.
- Parameters:
key (str or iterable of str) – Column(s) to return.
preserve_loc_order (bool, default False) – Whether to preserve the order of the genome location columns. If False, the genome location columns will be moved to the left.
- Returns:
PyRanges with the requested columns.
- Return type:
See also
PyRanges.remove_nonloc_columnsremove all columns that are not genome location columns.
Examples
>>> gr = pr.PyRanges({"Chromosome": [1], "Start": [895], "Strand": ["+"], ... "Score": [1], "Score2": [2], "End": [1259]}) >>> gr index | Chromosome Start Strand Score Score2 End int64 | int64 int64 str int64 int64 int64 ------- --- ------------ ------- -------- ------- -------- ------- 0 | 1 895 + 1 2 1259 PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
Genomic location columns are moved to the left by default:
>>> gr.get_with_loc_columns(["Score2", "Score", "Score2"]) index | Chromosome Start End Strand Score2 Score Score2 int64 | int64 int64 int64 str int64 int64 int64 ------- --- ------------ ------- ------- -------- -------- ------- -------- 0 | 1 895 1259 + 2 1 2 PyRanges with 1 rows, 7 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr.get_with_loc_columns(["Score2", "Score"], preserve_loc_order=True) index | Chromosome Start Strand Score2 Score End int64 | int64 int64 str int64 int64 int64 ------- --- ------------ ------- -------- -------- ------- ------- 0 | 1 895 + 2 1 1259 PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr.get_with_loc_columns(["Score2", "Score", "Score2"], preserve_loc_order=True) Traceback (most recent call last): ... ValueError: Duplicate keys not allowed when preserve_loc_order is True.
- group_cumsum(group_by: str | Iterable[str] | None = None, *, use_strand: Literal['auto'] | bool = 'auto', cumsum_start_column: str | None = None, cumsum_end_column: str | None = None, keep_order: bool = True) PyRanges
Strand-aware cumulative length of every interval within each chromosome-level group.
For every chromosome (and, if supplied, every unique combination in group_by) the intervals are walked 5→3 on their own strand. Two new columns are added:
cumsum_start_column- running total before the intervalcumsum_end_column- running total after the interval
- Parameters:
group_by (str or list, default None) – Additional column(s) that must match for two intervals to share a cumulative coordinate space.
Chromosomealways does, andStrandtoo when use_strand resolves to True, so when None all intervals on the same chromosome and strand are cumulated together.cumsum_start_column (str | None, default None) – Names of the columns added to the returned frame. If None is given, Start and End is used.
cumsum_end_column (str | None, default None) – Names of the columns added to the returned frame. If None is given, Start and End is used.
use_strand ({"auto", True, False}, default: "auto") – Whether negative strand intervals should be sliced in descending order, meaning 5’ to 3’. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
keep_order (bool, default True) – Whether to output results in the original row order.
- Returns:
Copy of self with the two cumulative-length columns appended.
- Return type:
Examples
>>> gr = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_name"]) >>> gr = gr[gr.Feature == "exon"] >>> gr index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 2 | 1 11868 12227 + exon DDX11L1 3 | 1 12612 12721 + exon DDX11L1 4 | 1 13220 14409 + exon DDX11L1 5 | 1 112699 112804 - exon AL627309.1 6 | 1 110952 111357 - exon AL627309.1 8 | 1 133373 133723 - exon AL627309.1 9 | 1 129054 129223 - exon AL627309.1 10 | 1 120873 120932 - exon AL627309.1 PyRanges with 8 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands. >>> gr.group_cumsum(group_by="gene_name") index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 2 | 1 0 359 + exon DDX11L1 3 | 1 359 468 + exon DDX11L1 4 | 1 468 1657 + exon DDX11L1 5 | 1 578 683 - exon AL627309.1 6 | 1 683 1088 - exon AL627309.1 8 | 1 0 350 - exon AL627309.1 9 | 1 350 519 - exon AL627309.1 10 | 1 519 578 - exon AL627309.1 PyRanges with 8 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- groupby(*args, **kwargs) PyRangesDataFrameGroupBy
Groupby PyRanges.
- property has_strand: bool
Return whether PyRanges has a strand column.
Does not check whether the strand column contains valid values.
- intersect_overlaps(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', *, multiple: Literal['first', 'all', 'last'] = 'all', match_by: str | Iterable[str] | None = None, preserve_input_order: bool = True) PyRanges
Return overlapping subintervals.
Returns the segments of the intervals in self which overlap with those in other. When multiple intervals in ‘other’ overlap with the same interval in self, the result may be complex – read the argument ‘multiple’ for details.
- Parameters:
other (PyRanges) – PyRanges to find overlaps with.
multiple ({"all", "first", "last"}, default "all") – What intervals to report when multiple intervals in ‘other’ overlap with the same interval in self. The default “all” reports one subinterval per overlapping pair, which will have duplicate indices. “first” reports only the subinterval clipped against the interval of ‘other’ with the smallest Start; “last” clips against the one with the biggest End.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A PyRanges with overlapping intervals. Input index is preserved, but may contain duplicates.
- Return type:
See also
PyRanges.overlapreport overlapping (unmodified) intervals
PyRanges.subtract_overlapsreport non-overlapping subintervals
PyRanges.set_intersect_overlapsset-intersect PyRanges
Examples
>>> r1 = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [5, 20, 40],"End": [10, 30, 50], "ID": ["a", "b", "c"]}) >>> r1 index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 5 10 a 1 | chr1 20 30 b 2 | chr1 40 50 c PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> r2 = pr.PyRanges({"Chromosome": ["chr1"] * 4, "Start": [7, 18, 25, 28], "End": [9, 22, 33, 32]}) >>> r2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 7 9 1 | chr1 18 22 2 | chr1 25 33 3 | chr1 28 32 PyRanges with 4 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> r1.intersect_overlaps(r2) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 7 9 a 1 | chr1 20 22 b 1 | chr1 25 30 b 1 | chr1 28 30 b PyRanges with 4 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes.
>>> r1.intersect_overlaps(r2, multiple="first") index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 7 9 a 1 | chr1 20 22 b PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> r1.intersect_overlaps(r2, multiple="last") index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 7 9 a 1 | chr1 28 30 b PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
- join_overlaps(other: PyRanges, *, multiple: Literal['first', 'all', 'last'] = 'all', strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', join_type: Literal['inner', 'left', 'outer', 'right'] = 'inner', match_by: str | Iterable[str] | None = None, contained_intervals_only: bool = False, slack: int = 0, suffix: str = '_b', report_overlap_column: str | None = None, preserve_input_order: bool = True) PyRanges
Join PyRanges based on genomic overlap.
Find pairs of overlapping intervals between two PyRanges (self and other) and combine their columns. Each row in the return PyRanges contains columns of both intervals, including their coordinates. By default, intervals without overlap are not reported.
- Parameters:
other (PyRanges) – PyRanges to join.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
join_type ({"inner", "left", "right", "outer"}, default "inner") – How to handle intervals without overlap. “inner” means only keep overlapping intervals. “left” keeps all intervals in self, “right” keeps all intervals in other, “outer” keeps both. For types other than “inner”, intervals in self without overlaps will have NaN in columns from other, and/or vice versa.
multiple ({"all", "first", "last"}, default "all") – What intervals to report when multiple intervals in ‘other’ overlap with the same interval in self. The default “all” reports one row per overlapping pair, which will have duplicate indices. “first” attaches, for each interval in self, only the overlapping interval of ‘other’ with the smallest Start; “last” attaches only the one with the biggest End.
contained_intervals_only (bool, default False) – Whether to report only intervals that are entirely contained in an interval of ‘other’.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be joined.
report_overlap_column (str or None) – Report amount of overlap in base pairs using column name
slack (int, default 0) – Before joining, temporarily extend intervals in self by this much on both ends.
suffix (str or tuple, default "_b") – Suffix to give overlapping columns in other.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A PyRanges appended with columns of another.
- Return type:
Note
The index of the output is taken from the primary side of the join:
selffor “inner”, “left” and “outer”, andotherfor “right”. As a result the index may contain duplicates (when an interval has several overlaps) and, for “outer”/”right”, missing-side rows keep the index of the side they originate from. The chromosome column from other will never be reported as it is always the same as in self. Whether the strand column from other is reported depends on the strand_behavior.See also
PyRanges.combine_interval_columnsgive joined PyRanges new coordinates
PyRanges.compute_interval_metricscompute overlap metrics in joined PyRanges
Examples
>>> f1 = pr.PyRanges({'Chromosome': ['chr1', 'chr1', 'chr1'], ... 'Start': [3, 8, 5], ... 'End': [6, 9, 7], ... 'Name': ['interval1', 'interval3', 'interval2']}) >>> f1 index | Chromosome Start End Name int64 | str int64 int64 str ------- --- ------------ ------- ------- --------- 0 | chr1 3 6 interval1 1 | chr1 8 9 interval3 2 | chr1 5 7 interval2 PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> f2 = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], ... 'Start': [1, 6], ... 'End': [2, 7], ... 'Name': ['a', 'b']}) >>> f2 index | Chromosome Start End Name int64 | str int64 int64 str ------- --- ------------ ------- ------- ------ 0 | chr1 1 2 a 1 | chr1 6 7 b PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> f1.join_overlaps(f2) index | Chromosome Start End Name Start_b End_b Name_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- --------- --------- ------- -------- 2 | chr1 5 7 interval2 6 7 b PyRanges with 1 rows, 7 columns, and 1 index columns. Contains 1 chromosomes.
Note that since some start and end columns are NaN, a regular DataFrame is returned.
>>> f1.join_overlaps(f2, join_type="left") index | Chromosome Start End Name Start_b End_b Name_b int64 | str int64 int64 str float64 float64 str ------- --- ------------ ------- ------- --------- --------- --------- -------- 2 | chr1 5 7 interval2 6 7 b 0 | chr1 3 6 interval1 nan nan nan 1 | chr1 8 9 interval3 nan nan nan PyRanges with 3 rows, 7 columns, and 1 index columns. Contains 1 chromosomes.
>>> f1.join_overlaps(f2, join_type="outer") index | Chromosome Start End Name Start_b End_b Name_b int64 | str float64 float64 str float64 float64 str ------- --- ------------ --------- --------- --------- --------- --------- -------- 2 | chr1 5 7 interval2 6 7 b 0 | chr1 3 6 interval1 nan nan nan 1 | chr1 8 9 interval3 nan nan nan 0 | nan nan nan nan 1 2 a PyRanges with 4 rows, 7 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes. Invalid ranges: * 1 starts or ends are nan. See indexes: 0
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr2', 'chr1', 'chr3'], ... 'Start': [1, 4, 10, 0], ... 'End': [3, 9, 11, 1], ... 'ID': ['a', 'b', 'c', 'd']}) >>> gr index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 a 1 | chr2 4 9 b 2 | chr1 10 11 c 3 | chr3 0 1 d PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 3 chromosomes.
>>> gr2 = pr.PyRanges({'Chromosome': ['chr1', 'chr1', 'chr1'], ... 'Start': [2, 2, 1], ... 'End': [3, 9, 10], ... 'ID': ['a', 'b', 'c']}) >>> gr2 index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 2 3 a 1 | chr1 2 9 b 2 | chr1 1 10 c PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.join_overlaps(gr2) index | Chromosome Start End ID Start_b End_b ID_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- ----- --------- ------- ------ 0 | chr1 1 3 a 2 3 a 0 | chr1 1 3 a 2 9 b 0 | chr1 1 3 a 1 10 c PyRanges with 3 rows, 7 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes.
>>> gr.join_overlaps(gr2, match_by="ID") index | Chromosome Start End ID Start_b End_b int64 | str int64 int64 str int64 int64 ------- --- ------------ ------- ------- ----- --------- ------- 0 | chr1 1 3 a 2 3 PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes.
>>> bad = f1.join_overlaps(f2, join_type="right") >>> bad index | Chromosome Start End Name Start_b End_b Name_b int64 | str float64 float64 str int64 int64 str ------- --- ------------ --------- --------- --------- --------- ------- -------- 1 | chr1 5 7 interval2 6 7 b 0 | nan nan nan nan 1 2 a PyRanges with 2 rows, 7 columns, and 1 index columns. Contains 1 chromosomes. Invalid ranges: * 1 starts or ends are nan. See indexes: 0
With slack 1, bookended features are joined (see row 1):
>>> f1.join_overlaps(f2, slack=1) index | Chromosome Start End Name Start_b End_b Name_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- --------- --------- ------- -------- 0 | chr1 3 6 interval1 6 7 b 2 | chr1 5 7 interval2 6 7 b PyRanges with 2 rows, 7 columns, and 1 index columns. Contains 1 chromosomes.
>>> f1.join_overlaps(f2, report_overlap_column="Overlap") index | Chromosome Start End Name Start_b End_b Name_b Overlap int64 | str int64 int64 str int64 int64 str int64 ------- --- ------------ ------- ------- --------- --------- ------- -------- --------- 2 | chr1 5 7 interval2 6 7 b 1 PyRanges with 1 rows, 8 columns, and 1 index columns. Contains 1 chromosomes.
Allowing slack in overlaps may result in 0 or negative Overlap values:
>>> f1.join_overlaps(f2, report_overlap_column="Overlap", slack=2) index | Chromosome Start End Name Start_b End_b Name_b Overlap int64 | str int64 int64 str int64 int64 str int64 ------- --- ------------ ------- ------- --------- --------- ------- -------- --------- 0 | chr1 3 6 interval1 1 2 a -1 0 | chr1 3 6 interval1 6 7 b 0 1 | chr1 8 9 interval3 6 7 b -1 2 | chr1 5 7 interval2 6 7 b 1 PyRanges with 4 rows, 8 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes.
- property length: int
Return the total length of the intervals.
See also
PyRanges.lengthsreturn the intervals lengths
Examples
>>> gr = pr.example_data.f1 >>> gr index | Chromosome Start End Name Score Strand int64 | category int64 int64 str int64 category ------- --- ------------ ------- ------- --------- ------- ---------- 0 | chr1 3 6 interval1 0 + 1 | chr1 5 7 interval2 0 - 2 | chr1 8 9 interval3 0 + PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.length 6
To find the length of the genome covered by the intervals, use merge first:
>>> gr.merge_overlaps(use_strand=False).length 5
- lengths() Series
Return the length of each interval.
- Return type:
pd.Series or dict of pd.Series with the lengths of each interval.
See also
PyRanges.lengthreturn the total length of all intervals combined
Examples
>>> gr = pr.example_data.f1 >>> gr index | Chromosome Start End Name Score Strand int64 | category int64 int64 str int64 category ------- --- ------------ ------- ------- --------- ------- ---------- 0 | chr1 3 6 interval1 0 + 1 | chr1 5 7 interval2 0 - 2 | chr1 8 9 interval3 0 + PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.lengths() 0 3 1 2 2 1 dtype: int64
>>> gr["Length"] = gr.lengths() >>> gr index | Chromosome Start End Name Score Strand Length int64 | category int64 int64 str int64 category int64 ------- --- ------------ ------- ------- --------- ------- ---------- -------- 0 | chr1 3 6 interval1 0 + 3 1 | chr1 5 7 interval2 0 - 2 2 | chr1 8 9 interval3 0 + 1 PyRanges with 3 rows, 7 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- property loc_columns: list[str]
Return the names of genomic location columns of this PyRanges (Chromosome, and Strand if present).
- property loci: LociGetter
Get or set rows based on genomic location.
- Parameters:
key – Genomic location: one or more of Chromosome, Strand, and Range (i.e. Start:End). When a Range is specified, only rows that overlap with it are returned.
- Returns:
PyRanges view with rows matching the location.
- Return type:
Warning
When strand is provided but chromosome is not, only valid strand values (‘+’, ‘-’) are searched for. Use the complete .loci[Chromosome, Strand, Range] syntax to search for non-genomic strands. Each item can be None to match all values.
Examples
>>> import pyranges1 as pr >>> gr = pr.example_data.ensembl_gtf.get_with_loc_columns(["gene_id", "gene_name"]) >>> gr index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 2 | 1 11868 12227 + ENSG00000223972 DDX11L1 3 | 1 12612 12721 + ENSG00000223972 DDX11L1 ... | ... ... ... ... ... ... 7 | 1 120724 133723 - ENSG00000238009 AL627309.1 8 | 1 133373 133723 - ENSG00000238009 AL627309.1 9 | 1 129054 129223 - ENSG00000238009 AL627309.1 10 | 1 120873 120932 - ENSG00000238009 AL627309.1 PyRanges with 11 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.loci[1, "+", 12227:13000] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 3 | 1 12612 12721 + ENSG00000223972 DDX11L1 PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr.loci[1, 14408:120000] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 4 | 1 13220 14409 + ENSG00000223972 DDX11L1 5 | 1 112699 112804 - ENSG00000238009 AL627309.1 6 | 1 110952 111357 - ENSG00000238009 AL627309.1 PyRanges with 5 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.loci[1, "-"] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 5 | 1 112699 112804 - ENSG00000238009 AL627309.1 6 | 1 110952 111357 - ENSG00000238009 AL627309.1 7 | 1 120724 133723 - ENSG00000238009 AL627309.1 8 | 1 133373 133723 - ENSG00000238009 AL627309.1 9 | 1 129054 129223 - ENSG00000238009 AL627309.1 10 | 1 120873 120932 - ENSG00000238009 AL627309.1 PyRanges with 6 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr.loci["+"] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 2 | 1 11868 12227 + ENSG00000223972 DDX11L1 3 | 1 12612 12721 + ENSG00000223972 DDX11L1 4 | 1 13220 14409 + ENSG00000223972 DDX11L1 PyRanges with 5 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr.loci[11000:12000] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 2 | 1 11868 12227 + ENSG00000223972 DDX11L1 PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
The Chromosome column is attempted to be converted to the type of the provided key before matching:
>>> gr.loci["1", 11000:12000] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------------- ----------- 0 | 1 11868 14409 + ENSG00000223972 DDX11L1 1 | 1 11868 14409 + ENSG00000223972 DDX11L1 2 | 1 11868 12227 + ENSG00000223972 DDX11L1 PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
When requesting non-existing chromosome or strand or ranges an empty PyRanges is returned:
>>> gr.loci["3"] index | Chromosome Start End Strand gene_id gene_name int64 | category int64 int64 category str str ------- --- ------------ ------- ------- ---------- --------- ----------- PyRanges with 0 rows, 6 columns, and 1 index columns. Contains 0 chromosomes and 0 strands.
>>> gr2 = pr.PyRanges({"Chromosome": ["chr1", "chr2"], "Start": [1, 2], "End": [4, 5], ... "Strand": [".", "+"], "Score":[10, 12], "Id":["a", "b"]}) >>> gr2.loci["chr2"] index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- 1 | chr2 2 5 + 12 b PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
The loci operator can also be used for assignment, using a same-sized PyRanges:
>>> gr2.loci["chr2"] = gr2.loci["chr2"].copy().assign(Chromosome="xxx") >>> gr2 index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- 0 | chr1 1 4 . 10 a 1 | xxx 2 5 + 12 b PyRanges with 2 rows, 6 columns, and 1 index columns. Contains 2 chromosomes and 2 strands (including non-genomic strands: .).
For more flexible assignment, you can employ Pandas loc using the index of the loci output:
>>> c = gr2.loci["chr1"] >>> gr2.loc[c.index, "Score"] = 100 >>> gr2 index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- 0 | chr1 1 4 . 100 a 1 | xxx 2 5 + 12 b PyRanges with 2 rows, 6 columns, and 1 index columns. Contains 2 chromosomes and 2 strands (including non-genomic strands: .).
When providing only strand, or strand and a slice, only valid genomic strands (i.e. ‘+’, ‘-’) are searched for:
>>> gr2.loci['+'] index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- 1 | xxx 2 5 + 12 b PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> gr2.loci['.'] index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- PyRanges with 0 rows, 6 columns, and 1 index columns. Contains 0 chromosomes and 0 strands.
You can use None to match all values, useful to force the non-ambiguous syntax that can match non-genomic strands:
>>> gr2.loci[None, '.'] index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- 0 | chr1 1 4 . 100 a PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands (including non-genomic strands: .).
Do not try to use loci to access columns: the key is interpreted as a chromosome, resulting in empty output:
>>> gr2.loci["Score"] index | Chromosome Start End Strand Score Id int64 | str int64 int64 str int64 str ------- --- ------------ ------- ------- -------- ------- ----- PyRanges with 0 rows, 6 columns, and 1 index columns. Contains 0 chromosomes and 0 strands.
>>> gr2.loci[["Score", "Id"]] Traceback (most recent call last): ... TypeError: The loci accessor does not accept a list. If you meant to retrieve columns, use get_with_loc_columns instead.
- make_strand_valid() PyRanges
Make the strand information in PyRanges valid.
Convert all invalid Strand values (those other than “+” and “-”) to positive stranded values “+”. If the Strand column is not present, add it with all values set to “+”.
- Returns:
PyRanges with valid strand information.
- Return type:
See also
PyRanges.strand_validwhether PyRanges has valid strand info
PyRanges.remove_strandremove the Strand column from PyRanges
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], 'Start': [1, 6], ... 'End': [5, 8], 'Strand': ['-', '.']}) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 - 1 | chr1 6 8 . PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands (including non-genomic strands: .).
>>> gr.strand_valid False
>>> gr.make_strand_valid() index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 - 1 | chr1 6 8 + PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr2 = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], 'Start': [5, 22], ... 'End': [15, 30]}) >>> gr2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 5 15 1 | chr1 22 30 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr2.make_strand_valid() index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 5 15 + 1 | chr1 22 30 + PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
- map_to_global(gr: PyRanges, global_on: str, *, local_on: str = 'Chromosome', keep_id: bool = False, keep_loc: bool = False, pep_to_cds: bool = False) PyRanges
Map intervals from a local reference frame (e.g. transcript) to global coordinates (e.g. genomic).
The self PyRanges object is local in the sense that its
Chromosomecolumn stores an identifier (e.g. a transcript ID), so that its interval coordinates are expressed relative to that identifier. The global object gr supplies the absolute genomic coordinates of every interval group (e.g. annotation of transcripts, potentially with multiple exons). The function returns the self intervals in the reference system of the global object.The strand of returned intervals is the product of the strand of the corresponding local and global intervals (e.g. +/- => -)
Unused rows in gr (identifiers never referenced by
self) are ignored.- Parameters:
gr (PyRanges) – Intervals in global reference system (e.g. transcript annotation in genomic coordinates).
global_on (str) – Column in gr that holds the identifiers contained in
self.Chromosome.local_on (str, default "Chromosome") – Column in self that holds the identifier to be lifted. Change this if your identifiers live in a different column.
keep_id (bool, default False) – If True, keep the identifier column (Chromosome in self) in the output.
keep_loc (bool, default False) – If True, keep the local location columns (Start, End, Strand) in the output.
pep_to_cds (bool, default False) – If True, the function will assume that the intervals in self are peptide coordinates and those in gr are CDS coordinates. Thus,
selfcoordinates are multiplied by 3 before mapping to global.
- Returns:
Intervals in genomic coordinates, maintaining order, index, and metadata columns of self.
- Return type:
Warning
A single local interval will give rise to multiple intervals in output if it overlaps discontinuities (i.e. introns) in global coordinates. This will generate duplicated indices. To avoid them, run pandas dataframe method
reset_indexon the output.Examples
>>> gr = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["chr1","chr1","chr1","chr1"], ... "Start": [100, 300, 1000, 1100], ... "End": [200, 400, 1050, 1200], ... "Strand": ["+","+", "-", "-"], ... "transcript_id": ["tx1","tx1","tx2","tx2"], ... })) >>> tr = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["tx1","tx1","tx1","tx2","tx2"], ... "Start": [0, 120, 160, 0, 100], ... "End": [80, 140, 170, 20, 130], ... "Strand": ["-","-", "+", "+", "+"], ... "label": ["a","b","c","d","e"], ... })) >>> gr index | Chromosome Start End Strand transcript_id int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- --------------- 0 | chr1 100 200 + tx1 1 | chr1 300 400 + tx1 2 | chr1 1000 1050 - tx2 3 | chr1 1100 1200 - tx2 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> tr index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | tx1 0 80 - a 1 | tx1 120 140 - b 2 | tx1 160 170 + c 3 | tx2 0 20 + d 4 | tx2 100 130 + e PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 2 chromosomes and 2 strands.
>>> tr.map_to_global(gr, "transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | chr1 100 180 - a 1 | chr1 320 340 - b 2 | chr1 360 370 + c 3 | chr1 1180 1200 - d 4 | chr1 1020 1050 - e PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> tr.map_to_global(gr, "transcript_id", keep_id=True) index | Chromosome Start End Strand label transcript_id int64 | str int64 int64 str str str ------- --- ------------ ------- ------- -------- ------- --------------- 0 | chr1 100 180 - a tx1 1 | chr1 320 340 - b tx1 2 | chr1 360 370 + c tx1 3 | chr1 1180 1200 - d tx2 4 | chr1 1020 1050 - e tx2 PyRanges with 5 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> tr.map_to_global(gr, "transcript_id", keep_loc=True) index | Chromosome Start End Strand label Start_local End_local Strand_local int64 | str int64 int64 str str int64 int64 str ------- --- ------------ ------- ------- -------- ------- ------------- ----------- -------------- 0 | chr1 100 180 - a 0 80 - 1 | chr1 320 340 - b 120 140 - 2 | chr1 360 370 + c 160 170 + 3 | chr1 1180 1200 - d 0 20 + 4 | chr1 1020 1050 - e 100 130 + PyRanges with 5 rows, 8 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Metadata columns are preserved:
>>> tr.assign(tag=7).map_to_global(gr, "transcript_id").tag.unique() array([7])
A local interval that spans an exon junction is split; its index is duplicated in the output.
>>> tr2 = pr.PyRanges(pd.DataFrame({ ... "Chromosome":["tx1","tx2","tx2"], ... "Start": [90, 80, 50], ... "End": [110, 120, 120], ... "Strand": ["+","+", "-"], ... "label": ["q","w","e"], ... })) >>> tr2.map_to_global(gr, "transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | chr1 190 200 + q 0 | chr1 300 310 + q 1 | chr1 1030 1050 - w 1 | chr1 1100 1120 - w 2 | chr1 1030 1050 + e 2 | chr1 1100 1150 + e PyRanges with 6 rows, 5 columns, and 1 index columns (with 3 index duplicates). Contains 1 chromosomes and 2 strands.
A local interval longer than its transcript is truncated to the portion that fits.
>>> tr3 = pr.PyRanges(pd.DataFrame({ ... "Chromosome":["tx1"], "Start":[20], "End":[1000], "Strand":["+"] ... })) >>> tr3.map_to_global(gr, "transcript_id") index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 120 200 + 0 | chr1 300 400 + PyRanges with 2 rows, 4 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes and 1 strands.
Mapping proteins to CDS global positions. Get some protein-based features:
>>> gr = pr.example_data.ncbi_gff >>> grc = gr[gr.Feature == "CDS"].get_with_loc_columns('Parent') >>> genome_file = pr.example_data.files['ncbi.fasta'] >>> cdss = grc.get_sequence(genome_file, group_by='Parent').str.upper() >>> prots = pr.seqs.translate(cdss) >>> z = [(seq_id, i, 'R') for seq_id, seq in prots.items() for i, char in enumerate(seq) if char == 'R'] >>> z = pd.DataFrame(z, columns=['ID', 'Start', 'AminoAcid']).assign(End=lambda df: df.Start + 1 ) >>> arginines_pos = pr.PyRanges(z.rename(columns={"ID": "Chromosome"})) >>> arginines_pos index | Chromosome Start AminoAcid End int64 | str int64 str int64 ------- --- --------------------- ------- ----------- ------- 0 | rna-DGYR_LOCUS12552 7 R 8 1 | rna-DGYR_LOCUS12552 15 R 16 2 | rna-DGYR_LOCUS12552 25 R 26 3 | rna-DGYR_LOCUS12552 89 R 90 ... | ... ... ... ... 158 | rna-DGYR_LOCUS14095-2 271 R 272 159 | rna-DGYR_LOCUS14095-2 309 R 310 160 | rna-DGYR_LOCUS14095-2 320 R 321 161 | rna-DGYR_LOCUS14095-2 327 R 328 PyRanges with 162 rows, 4 columns, and 1 index columns. Contains 17 chromosomes.
>>> genome_arginine_pos = arginines_pos.map_to_global(grc, "Parent", pep_to_cds=True, keep_id=True) >>> genome_arginine_pos['codon'] = genome_arginine_pos.get_sequence(genome_file).str.upper() >>> genome_arginine_pos index | Chromosome Start AminoAcid End Parent Strand codon int64 | category int64 str int64 str category object ------- --- ----------------- ------- ----------- ------- --------------------- ---------- -------- 0 | CAJFCJ010000025.1 2671 R 2674 rna-DGYR_LOCUS12552 - CGT 1 | CAJFCJ010000025.1 2647 R 2650 rna-DGYR_LOCUS12552 - AGA 2 | CAJFCJ010000025.1 2617 R 2620 rna-DGYR_LOCUS12552 - AGA 3 | CAJFCJ010000025.1 2369 R 2372 rna-DGYR_LOCUS12552 - AGA ... | ... ... ... ... ... ... ... 159 | CAJFCJ010000097.1 52993 R 52996 rna-DGYR_LOCUS14095-2 + AGA 160 | CAJFCJ010000097.1 53026 R 53027 rna-DGYR_LOCUS14095-2 + A 160 | CAJFCJ010000097.1 53339 R 53341 rna-DGYR_LOCUS14095-2 + GA 161 | CAJFCJ010000097.1 53359 R 53362 rna-DGYR_LOCUS14095-2 + AGA PyRanges with 164 rows, 7 columns, and 1 index columns (with 2 index duplicates). Contains 3 chromosomes and 2 strands.
- map_to_local(ref, ref_on, *, match_by: str | Iterable[str] | None = None, keep_chrom: bool = False, keep_loc: bool = False) PyRanges
Map global genomic intervals (
self) onto a local frame defined by reference rangesref.Both
selfandrefare given in genomic coordinates.refholds the layout of every local entity (typically the exons that compose each transcript). Each interval inselfthat overlap withrefis re-based so that the returnedStart/Endare measured from the 5’ end of the entire transcript ofref, with introns removed. For instance, if the first exon of areftranscript is 100 nt long, the first base of the second exon has local coordinate 100.Intervals in
selfare mapped to every transcript they overlap; non-overlapping intervals are not reported.refmust contain a column whose name is supplied in ref_on. Those values become theChromosomecolumn of the output.The strand of each returned interval is the “product” of the strands of the overlapping pair (e.g. + x. - → -).
- Parameters:
ref (PyRanges) – Reference ranges in genomic coordinates that define the new coordinate system (e.g. multi-exon transcript annotation).
ref_on (str) – Column in
refthat groups intervals into transcripts. Values are copied intoChromosomein the output.match_by (str or list[str], optional) – If provided, only overlapping intervals with an equal value in column(s) match_by are reported.
keep_chrom (bool, default False) – If True, keep the global Chromosome column in the output.
keep_loc (bool, default False) – If True, keep the original global location columns (Start, End, Strand) in the output.
- Returns:
Intervals remapped to local (transcript) coordinates, preserving the original row order, index and metadata columns of
self.- Return type:
Warning
*A single
selfinterval may overlap severalrefexons, or different transcripts. In that case its index repeats in the output. Callreset_index()afterwards if you need unique indices.Examples
>>> import pandas as pd, pyranges1 as pr >>> tr = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["chr1","chr1","chr1","chr1"], ... "Start": [ 100, 300, 1000, 1100], ... "End": [ 200, 400, 1050, 1200], ... "Strand": ["+","+", "-","-"], ... "transcript_id":["tx1","tx1","tx2","tx2"], ... })) >>> g1 = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["chr1","chr1","chr1","chr1","chr1","chr1","chr1"], ... "Start": [ 110, 220, 320, 340, 500, 1030, 1180], ... "End": [ 180, 240, 340, 360, 550, 1050, 1200], ... "Strand": ["+","+", "+", "-","+", "-","+"], ... "label": ["a","no_overlap_intronic","b","c", ... "no_overlap_intergenic","d","e"], ... }))
>>> tr index | Chromosome Start End Strand transcript_id int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- --------------- 0 | chr1 100 200 + tx1 1 | chr1 300 400 + tx1 2 | chr1 1000 1050 - tx2 3 | chr1 1100 1200 - tx2 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> g1 index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- --------------------- 0 | chr1 110 180 + a 1 | chr1 220 240 + no_overlap_intronic 2 | chr1 320 340 + b 3 | chr1 340 360 - c 4 | chr1 500 550 + no_overlap_intergenic 5 | chr1 1030 1050 - d 6 | chr1 1180 1200 + e PyRanges with 7 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> g1.map_to_local(tr, "transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | tx1 10 80 + a 2 | tx1 120 140 + b 3 | tx1 140 160 - c 5 | tx2 100 120 + d 6 | tx2 0 20 - e PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 2 chromosomes and 2 strands.
A genomic interval spanning two exons is split:
>>> g2 = pr.PyRanges(pd.DataFrame({ ... "Chromosome":["chr1"], "Start":[180], "End":[330], ... "Strand":["+"], "label":["q"]})) >>> g2.map_to_local(tr, "transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | tx1 80 100 + q 0 | tx1 100 130 + q PyRanges with 2 rows, 5 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes and 1 strands.
Self intervals that overlaps multiple target ranges are reported as many times:
>>> tr2 = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["chr1","chr1","chr1","chr1"], ... "Start": [ 100, 300, 110, 300], ... "End": [ 200, 400, 200, 380], ... "Strand": ["+","+","-","-"], ... "transcript_id":["tx1.1","tx1.1","tx1.2","tx1.2"], ... }))
>>> g3 = pr.PyRanges(pd.DataFrame({ ... "Chromosome": ["chr1"], "Start": [150], "End": [180], "Strand": ["+"], "label": ["x"]}))
>>> g3.map_to_local(tr2, "transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | tx1.1 50 80 + x 0 | tx1.2 100 130 - x PyRanges with 2 rows, 5 columns, and 1 index columns (with 1 index duplicates). Contains 2 chromosomes and 2 strands.
>>> g3.map_to_local(tr2, "transcript_id", keep_chrom=True) index | Chromosome Start End Strand label Chromosome_global int64 | str int64 int64 str str str ------- --- ------------ ------- ------- -------- ------- ------------------- 0 | tx1.1 50 80 + x chr1 0 | tx1.2 100 130 - x chr1 PyRanges with 2 rows, 6 columns, and 1 index columns (with 1 index duplicates). Contains 2 chromosomes and 2 strands.
>>> g3.map_to_local(tr2, "transcript_id", keep_loc=True) index | Chromosome Start End Strand label Start_global End_global Strand_global int64 | str int64 int64 str str int64 int64 str ------- --- ------------ ------- ------- -------- ------- -------------- ------------ --------------- 0 | tx1.1 50 80 + x 100 200 + 0 | tx1.2 100 130 - x 110 200 - PyRanges with 2 rows, 8 columns, and 1 index columns (with 1 index duplicates). Contains 2 chromosomes and 2 strands.
Explicitly restrict what to report using match_by:
>>> g4 = g3.assign(transcript_id="tx1.1") >>> g4.map_to_local(tr2, "transcript_id", match_by="transcript_id") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | tx1.1 50 80 + x PyRanges with 1 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
>>> tr3 = tr2.copy() >>> tr3["label"] = ["x", "b", "c", "d"] >>> g4.map_to_local(tr3, "transcript_id", match_by="label") index | Chromosome Start End Strand label transcript_id int64 | str int64 int64 str str str ------- --- ------------ ------- ------- -------- ------- --------------- 0 | tx1.1 50 80 + x tx1.1 PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
- max_disjoint_overlaps(use_strand: Literal['auto'] | bool = 'auto', *, slack: int = 0, match_by: str | Iterable[str] | None = None, preserve_input_order: bool = True) PyRanges
Find the maximal disjoint set of intervals.
Returns a subset of the rows in self so that no two intervals overlap, choosing those that maximize the number of intervals in the result.
- Parameters:
use_strand ({"auto", True, False}, default: "auto") – Find the max-disjoint set separately for each strand. The default
"auto"meansTrueifPyRangeshas valid strands (see .strand_valid).slack (int, default 0) – Length by which the criteria of overlap are loosened. A value of
1implies that book-ended intervals are considered overlapping. Higher values allow more distant intervals (with a maximum distance ofslack-1between them).match_by (str or list, default
None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A
PyRangescontaining the maximal disjoint set of intervals.- Return type:
See also
PyRanges.merge_overlapsmerge intervals into non-overlapping super-intervals
PyRanges.split_overlapssplit intervals into non-overlapping sub-intervals
PyRanges.clusterannotate overlapping intervals with a common ID
Examples
>>> gr = pr.example_data.f1 >>> gr index | Chromosome Start End Name Score Strand int64 | category int64 int64 str int64 category ------- --- ------------ ------- ------- --------- ------- ---------- 0 | chr1 3 6 interval1 0 + 1 | chr1 5 7 interval2 0 - 2 | chr1 8 9 interval3 0 + PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.max_disjoint_overlaps(use_strand=False) index | Chromosome Start End Name Score Strand int64 | category int64 int64 str int64 category ------- --- ------------ ------- ------- --------- ------- ---------- 0 | chr1 3 6 interval1 0 + 2 | chr1 8 9 interval3 0 + PyRanges with 2 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
Strand-aware selection
>>> c = pr.PyRanges(dict( ... Chromosome=["chr1"] * 8, ... Start=[1, 4, 10, 12, 19, 20, 24, 28], ... End=[5, 7, 14, 16, 27, 22, 25, 30], ... Strand=["+", "+", "+", "-", "+", "+", "+", "+"] ... )) >>> c index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 + 1 | chr1 4 7 + 2 | chr1 10 14 + 3 | chr1 12 16 - 4 | chr1 19 27 + 5 | chr1 20 22 + 6 | chr1 24 25 + 7 | chr1 28 30 + PyRanges with 8 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> c.max_disjoint_overlaps(use_strand=True) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 + 2 | chr1 10 14 + 3 | chr1 12 16 - 4 | chr1 19 27 + 7 | chr1 28 30 + PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Using match_by to exempt rows from mutual overlap
>>> c3 = c.copy() >>> c3["label"] = [f"x{i}" for i in range(len(c3))] >>> c3.max_disjoint_overlaps(match_by="label") index | Chromosome Start End Strand label int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------- 0 | chr1 1 5 + x0 1 | chr1 4 7 + x1 2 | chr1 10 14 + x2 3 | chr1 12 16 - x3 4 | chr1 19 27 + x4 5 | chr1 20 22 + x5 6 | chr1 24 25 + x6 7 | chr1 28 30 + x7 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- merge_overlaps(use_strand: Literal['auto'] | bool = 'auto', *, count_col: str | None = None, match_by: str | Iterable[str] | None = None, slack: int = 0) PyRanges
Merge overlapping intervals into one.
Returns a PyRanges with superintervals that are the union of overlapping intervals.
- Parameters:
use_strand ({"auto", True, False}, default: "auto") – Only merge intervals on same strand. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
count_col (str or None, default None) – Name of the column storing the number of intervals merged into each superinterval. If None, no count column is added.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.
slack (int, default 0) – Allow this many nucleotides between each interval to merge.
- Returns:
PyRanges with superintervals. Metadata columns, index, and order are not preserved.
- Return type:
Note
To avoid losing metadata, use cluster instead. If you want to perform a reduction function on the metadata, use pandas groupby.
See also
PyRanges.clusterannotate overlapping intervals with common ID
PyRanges.max_disjoint_overlapsfind the maximal disjoint set of intervals
PyRanges.split_overlapssplit intervals into non-overlapping subintervals
Examples
>>> gr = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_name"]) >>> gr index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 0 | 1 11868 14409 + gene DDX11L1 1 | 1 11868 14409 + transcript DDX11L1 2 | 1 11868 12227 + exon DDX11L1 3 | 1 12612 12721 + exon DDX11L1 ... | ... ... ... ... ... ... 7 | 1 120724 133723 - transcript AL627309.1 8 | 1 133373 133723 - exon AL627309.1 9 | 1 129054 129223 - exon AL627309.1 10 | 1 120873 120932 - exon AL627309.1 PyRanges with 11 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.merge_overlaps(count_col="Count") index | Chromosome Start End Strand Count int64 | category int64 int64 category uint32 ------- --- ------------ ------- ------- ---------- -------- 0 | 1 11868 14409 + 5 1 | 1 110952 111357 - 1 2 | 1 112699 112804 - 1 3 | 1 120724 133723 - 4 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.merge_overlaps(count_col="Count", match_by="gene_name") index | Chromosome Start End Strand gene_name Count int64 | category int64 int64 category str uint32 ------- --- ------------ ------- ------- ---------- ----------- -------- 0 | 1 11868 14409 + DDX11L1 5 1 | 1 110952 111357 - AL627309.1 1 2 | 1 112699 112804 - AL627309.1 1 3 | 1 120724 133723 - AL627309.1 4 PyRanges with 4 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- nearest_ranges(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', direction: Literal['any', 'upstream', 'downstream'] = 'any', *, k: int = 1, match_by: str | Iterable[str] | None = None, suffix: str = '_b', exclude_overlaps: bool = False, dist_col: str | None = 'Distance', ties: Literal['all', 'first'] = 'all', preserve_input_order: bool = True) PyRanges
Find closest interval.
For each interval in self PyRanges, the columns of the nearest interval in other PyRanges are appended.
- Parameters:
other (PyRanges) – PyRanges to find nearest interval in.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
exclude_overlaps (bool, default True) – Whether to not report intervals of others that overlap with self as the nearest ones.
direction ({"any", "upstream", "downstream"}, default "any", i.e. both directions) – Whether to only look for nearest in one direction.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be matched.
k (int, default 1) – Number of nearest intervals to fetch.
suffix (str, default "_b") – Suffix to give columns with shared name in other.
dist_col (str or None) – Optional column to store the distance in.
ties ({"all", "first"}, default "all") –
What to report when several intervals of other sit at the same distance. “all” reports every one of them, “first” reports one per distance, so at most k rows per interval of self. Which one is not specified, only that the same input gives the same answer.
Overlapping intervals are all at distance 0, so unless exclude_overlaps is set this decides whether an interval of self covered by many intervals of other comes back once or once per overlap.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A PyRanges with columns representing nearest interval horizontally appended.
- Return type:
See also
PyRanges.join_overlapsHas a slack argument to find intervals within a distance.
Examples
>>> f1 = pr.example_data.f1.remove_nonloc_columns() >>> f1 index | Chromosome Start End Strand int64 | category int64 int64 category ------- --- ------------ ------- ------- ---------- 0 | chr1 3 6 + 1 | chr1 5 7 - 2 | chr1 8 9 + PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f2 = pr.PyRanges(dict(Chromosome="chr1", Start=[1, 6, 20], End=[2, 7, 22], Strand=["+", "-", "+"])) >>> f2 index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 2 + 1 | chr1 6 7 - 2 | chr1 20 22 + PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f1.nearest_ranges(f2) index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 1 2 + 2 1 | chr1 5 7 - chr1 6 7 - 0 2 | chr1 8 9 + chr1 1 2 + 7 PyRanges with 3 rows, 9 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f1.nearest_ranges(f2, strand_behavior='ignore') index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 6 7 - 1 1 | chr1 5 7 - chr1 6 7 - 0 2 | chr1 8 9 + chr1 6 7 - 2 PyRanges with 3 rows, 9 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> f1.nearest_ranges(f2, k=2, strand_behavior='ignore') index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 6 7 - 1 0 | chr1 3 6 + chr1 1 2 + 2 1 | chr1 5 7 - chr1 6 7 - 0 1 | chr1 5 7 - chr1 1 2 + 4 2 | chr1 8 9 + chr1 6 7 - 2 2 | chr1 8 9 + chr1 1 2 + 7 PyRanges with 6 rows, 9 columns, and 1 index columns (with 3 index duplicates). Contains 1 chromosomes and 2 strands.
>>> left = pr.PyRanges({"Chromosome": ["chr1", "chr1"], "Start": [10, 1], "End": [14, 2]}) >>> right = pr.PyRanges( ... {"Chromosome": ["chr1", "chr1"], "Start": [4, 1], "End": [6, 6], "Hit": ["first", "second"]} ... ) >>> left.nearest_ranges(right, strand_behavior="ignore", dist_col=None) index | Chromosome Start End Chromosome_b Start_b End_b Hit_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- -------------- --------- ------- ------- 0 | chr1 10 14 chr1 4 6 first 0 | chr1 10 14 chr1 1 6 second 1 | chr1 1 2 chr1 1 6 second PyRanges with 3 rows, 7 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes.
>>> left.nearest_ranges(right, strand_behavior="ignore", dist_col=None, preserve_input_order=False) index | Chromosome Start End Chromosome_b Start_b End_b Hit_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- -------------- --------- ------- ------- 0 | chr1 10 14 chr1 1 6 second 0 | chr1 10 14 chr1 4 6 first 1 | chr1 1 2 chr1 1 6 second PyRanges with 3 rows, 7 columns, and 1 index columns (with 1 index duplicates). Contains 1 chromosomes.
Both intervals of right end at 6, so both are the same distance from chr1:10-14 and both are reported. ties=”first” reports one of them, leaving one row per interval of self:
>>> left.nearest_ranges(right, strand_behavior="ignore", dist_col=None, ties="first") index | Chromosome Start End Chromosome_b Start_b End_b Hit_b int64 | str int64 int64 str int64 int64 str ------- --- ------------ ------- ------- -------------- --------- ------- ------- 0 | chr1 10 14 chr1 1 6 second 1 | chr1 1 2 chr1 1 6 second PyRanges with 2 rows, 7 columns, and 1 index columns. Contains 1 chromosomes.
>>> f1.nearest_ranges(f2, strand_behavior='ignore', exclude_overlaps=True) index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 6 7 - 1 1 | chr1 5 7 - chr1 1 2 + 4 2 | chr1 8 9 + chr1 6 7 - 2 PyRanges with 3 rows, 9 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Touching intervals are not treated as overlapping, so they are reported as nearest intervals with distance 1:
>>> r1 = pr.PyRanges({"Chromosome": "chr1", "Start": [1], "End": [5], "Strand": ["+"]}) >>> r2 = pr.PyRanges({"Chromosome": "chr1", "Start": [5], "End": [10], "Strand": ["+"]}) >>> pd.DataFrame(r2.nearest_ranges(r1)) Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance 0 chr1 5 10 + chr1 1 5 + 1
>>> f1.nearest_ranges(f2, direction='downstream') index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 20 22 + 15 1 | chr1 5 7 - chr1 6 7 - 0 2 | chr1 8 9 + chr1 20 22 + 12 PyRanges with 3 rows, 9 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
If an input interval has no suitable nearest interval, these rows are dropped:
>>> f1.nearest_ranges(f2, direction='upstream', exclude_overlaps=True) index | Chromosome Start End Strand Chromosome_b Start_b End_b Strand_b Distance int64 | category int64 int64 category str int64 int64 str int64 ------- --- ------------ ------- ------- ---------- -------------- --------- ------- ---------- ---------- 0 | chr1 3 6 + chr1 1 2 + 2 2 | chr1 8 9 + chr1 1 2 + 7 PyRanges with 2 rows, 9 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
- outer_ranges(group_by: str | Iterable[str] | None = None, use_strand: Literal['auto'] | bool = 'auto') PyRanges
Return the boundaries (the minimum start and end) of groups of intervals (e.g. transcripts).
- Parameters:
group_by (str or list of str or None) – Name(s) of column(s) to group intervals (e.g. into multi-exon transcripts) If None, intervals are grouped by chromosome, and strand if present and valid (see .strand_valid).
use_strand ({"auto", True, False}, default: "auto") – Whether to cluster only intervals on the same strand. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
- Returns:
One interval per group, with the min(Start) and max(End) of the group
- Return type:
See also
PyRanges.complement_rangesreturn the internal complement of intervals, i.e. its introns.
Examples
>>> gr = pr.PyRanges({"Chromosome": [1, 1, 1], "Start": [1, 60, 110], "End": [40, 68, 130], ... "transcript_id": ["tr1", "tr1", "tr2"], "meta": ["a", "b", "c"]}) >>> >>> gr["Length"] = gr.lengths() >>> gr index | Chromosome Start End transcript_id meta Length int64 | int64 int64 int64 str str int64 ------- --- ------------ ------- ------- --------------- ------ -------- 0 | 1 1 40 tr1 a 39 1 | 1 60 68 tr1 b 8 2 | 1 110 130 tr2 c 20 PyRanges with 3 rows, 6 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.outer_ranges("transcript_id") index | Chromosome Start End transcript_id int64 | int64 int64 int64 str ------- --- ------------ ------- ------- --------------- 0 | 1 1 68 tr1 1 | 1 110 130 tr2 PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.outer_ranges() index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 1 130 PyRanges with 1 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
- overlap(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', slack: int = 0, *, multiple: bool = False, contained_intervals_only: bool = False, match_by: str | Iterable[str] | None = None, invert: bool = False, preserve_input_order: bool = True) PyRanges
Return overlapping intervals.
Returns the intervals in self which overlap with those in other.
- Parameters:
other (PyRanges) – PyRanges to find overlaps with.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
slack (int, default 0) – Intervals in self are temporarily extended by slack on both ends before overlap is calculated, so that we allow non-overlapping intervals to be considered overlapping if they are within less than slack distance e.g. slack=1 reports bookended intervals.
multiple (bool, default False) – What to report when several intervals of ‘other’ overlap the same interval of self. False reports each interval of self at most once; True reports it once per overlap, potentially resulting in duplicate indices. Only intervals of self are returned, so this option changes how many rows appear, never their content.
contained_intervals_only (bool, default False) – Whether to report only intervals that are entirely contained in an interval of ‘other’.
match_by (str or list, default None) – If provided, only overlapping intervals with an equal value in column(s) match_by are reported.
invert (bool, default False) – If True, return intervals that do not overlap instead, according to all criteria specified
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A PyRanges with overlapping intervals.
- Return type:
See also
PyRanges.intersect_overlapsreport overlapping subintervals
PyRanges.set_intersect_overlapsset-intersect PyRanges (e.g. merge then intersect)
Examples
>>> gr = pr.PyRanges({"Chromosome": ["chr1", "chr1", "chr2", "chr1", "chr3"], "Start": [1, 1, 4, 10, 0], ... "End": [3, 3, 9, 11, 1], "ID": ["A", "a", "b", "c", "d"]}) >>> gr2 = pr.PyRanges({"Chromosome": ["chr1", "chr1", "chr2"], "Start": [2, 2, 1], "End": [3, 9, 10]}) >>> gr index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 A 1 | chr1 1 3 a 2 | chr2 4 9 b 3 | chr1 10 11 c 4 | chr3 0 1 d PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 3 chromosomes.
>>> gr2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 2 3 1 | chr1 2 9 2 | chr2 1 10 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr.overlap(gr2) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 A 1 | chr1 1 3 a 2 | chr2 4 9 b PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr.overlap(gr2, multiple=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 A 0 | chr1 1 3 A 1 | chr1 1 3 a 1 | chr1 1 3 a 2 | chr2 4 9 b PyRanges with 5 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 2 chromosomes.
RangeFrame.overlap reads the same argument the same way; only the default differs, since a genomic overlap filters by default and a generic one does not:
>>> gr.overlap(gr2, multiple=True).index.tolist() [0, 0, 1, 1, 2] >>> gr.overlap(gr2, multiple=False).index.tolist() [0, 1, 2] >>> gr.overlap(gr2, multiple="all") Traceback (most recent call last): ... TypeError: overlap takes multiple as a bool: use True for 'all' or False for 'first'.
>>> a = pr.PyRanges({"Chromosome": ["chr1", "chr1"], "Start": [5, 1], "End": [7, 3], "ID": ["A", "B"]}) >>> b = pr.PyRanges({"Chromosome": ["chr1", "chr1"], "Start": [2, 6], "End": [4, 8]}) >>> a.overlap(b, multiple=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 5 7 A 1 | chr1 1 3 B PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> a.overlap(b, multiple=True, preserve_input_order=False) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 1 | chr1 1 3 B 0 | chr1 5 7 A PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.overlap(gr2, invert=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 3 | chr1 10 11 c 4 | chr3 0 1 d PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr.overlap(gr2, slack=2) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 A 1 | chr1 1 3 a 2 | chr2 4 9 b 3 | chr1 10 11 c PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr.overlap(gr2, slack=2, invert=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 4 | chr3 0 1 d PyRanges with 1 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.overlap(gr2, contained_intervals_only=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 2 | chr2 4 9 b PyRanges with 1 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.overlap(gr2, contained_intervals_only=True, invert=True) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 A 1 | chr1 1 3 a 3 | chr1 10 11 c 4 | chr3 0 1 d PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 2 chromosomes.
>>> gr3 = pr.PyRanges({"Chromosome": 1, "Start": [2, 4], "End": [3, 5], "Strand": ["+", "-"]}) >>> gr3 index | Chromosome Start End Strand int64 | int64 int64 int64 str ------- --- ------------ ------- ------- -------- 0 | 1 2 3 + 1 | 1 4 5 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr4 = pr.PyRanges({"Chromosome": 1, "Start": [0], "End": [10], "Strand": ["-"]}) >>> gr3.overlap(gr4, strand_behavior="opposite") index | Chromosome Start End Strand int64 | int64 int64 int64 str ------- --- ------------ ------- ------- -------- 0 | 1 2 3 + PyRanges with 1 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
- remove_nonloc_columns() PyRanges
Remove all columns that are not genome location columns (Chromosome, Start, End, Strand).
Examples
>>> gr = pr.PyRanges({"Chromosome": [1], "Start": [895], "Strand": ["+"], "Score": [1], "Score2": [2], "End": [1259]}) >>> gr index | Chromosome Start Strand Score Score2 End int64 | int64 int64 str int64 int64 int64 ------- --- ------------ ------- -------- ------- -------- ------- 0 | 1 895 + 1 2 1259 PyRanges with 1 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 1 strands. >>> gr.remove_nonloc_columns() index | Chromosome Start End Strand int64 | int64 int64 int64 str ------- --- ------------ ------- ------- -------- 0 | 1 895 1259 + PyRanges with 1 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
- remove_strand() PyRanges
Return a copy with the Strand column removed.
Strand is removed regardless of whether it contains valid strand info.
See also
PyRanges.strand_validwhether PyRanges has valid strand info
PyRanges.invert_strandinvert plus <-> minus Strand in all intervals
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], 'Start': [1, 6], ... 'End': [5, 8], 'Strand': ['+', '-']}) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 + 1 | chr1 6 8 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.remove_strand() index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 1 5 1 | chr1 6 8 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
- set_intersect_overlaps(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', *, multiple: Literal['first', 'all', 'last'] = 'all', match_by: str | Iterable[str] | None = None, preserve_input_order: bool = True) PyRanges
Return set-theoretical intersection.
Like intersect_overlaps, but both PyRanges are merged first.
- Parameters:
other (PyRanges) – PyRanges to set-intersect.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
multiple ({"all", "first", "last"}, default "all") – What to report when multiple merged intervals in ‘other’ overlap with the same merged interval in self. The default “all” reports all overlapping subintervals. “first” reports only, for each merged self interval, the overlapping ‘other’ subinterval with smallest Start “last” reports only the overlapping subinterval with the biggest End in ‘other’
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping. The merging of each input is grouped by these columns too, and they are carried into the result.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A PyRanges with overlapping subintervals. Input index is not preserved. No columns other than Chromosome, Start, End, and optionally Strand are returned.
- Return type:
See also
PyRanges.set_union_overlapsset-theoretical union
PyRanges.intersect_overlapsfind overlapping subintervals
PyRanges.overlapreport overlapping intervals
PyRanges.merge_overlapsmerge overlapping intervals
Examples
>>> r1 = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [5, 20, 40],"End": [10, 30, 50], "ID": ["a", "b", "c"]}) >>> r1 index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 5 10 a 1 | chr1 20 30 b 2 | chr1 40 50 c PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> r2 = pr.PyRanges({"Chromosome": ["chr1"] * 4, "Start": [7, 18, 25, 28], "End": [9, 22, 33, 32]}) >>> r2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 7 9 1 | chr1 18 22 2 | chr1 25 33 3 | chr1 28 32 PyRanges with 4 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> r1.set_intersect_overlaps(r2, multiple='first') index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 7 9 1 | chr1 20 22 PyRanges with 2 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> r1.set_intersect_overlaps(r2) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 7 9 1 | chr1 20 22 2 | chr1 25 30 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
- set_union_overlaps(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', *, match_by: str | Iterable[str] | None = None) PyRanges
Return set-theoretical union.
Returns the regions present in either self or other. Both PyRanges are merged first.
- Parameters:
other (PyRanges) – PyRanges to do union with.
strand_behavior ({"auto", "same", "opposite", "ignore"}, default "auto") – Whether to consider overlaps of intervals on the same strand, the opposite or ignore strand information. The default, “auto”, means use “same” if both PyRanges are stranded (see .strand_valid) otherwise ignore the strand information.
match_by (str or list, default None) – If provided, the union is taken separately within each group of equal values in column(s) match_by, which are carried into the result.
- Returns:
A PyRanges with the union of intervals. Input index is not preserved. No columns other than Chromosome, Start, End, and optionally Strand are returned.
- Return type:
See also
PyRanges.set_intersect_overlapsset-theoretical intersection
PyRanges.overlapreport overlapping intervals
PyRanges.merge_overlapsmerge overlapping intervals
Examples
>>> gr = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [1, 4, 10], ... "End": [3, 9, 11], "ID": ["a", "b", "c"]}) >>> gr index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 a 1 | chr1 4 9 b 2 | chr1 10 11 c PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr2 = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [2, 2, 9], "End": [3, 9, 10]}) >>> gr2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 2 3 1 | chr1 2 9 2 | chr1 9 10 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.set_union_overlaps(gr2) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 1 9 1 | chr1 9 10 2 | chr1 10 11 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
Merging bookended intervals:
>>> gr.set_union_overlaps(gr2).merge_overlaps(slack=1) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 1 11 PyRanges with 1 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
- slice_ranges(start: int | Sequence[int] | ndarray = 0, end: int | Sequence[int] | ndarray | None = None, group_by: str | Iterable[str] | None = None, use_strand: Literal['auto'] | bool = 'auto', *, count_introns: bool = False, preserve_input_order: bool = True) PyRanges
Return sub-intervals of self, cut according to start and end.
The slice window can be a single pair (scalar start, end) that is applied to every row, or one value per row supplied as a 1-D sequence or NumPy array. When vectors are used their length must equal the number of rows in self.
A positive coordinate is counted from the 5’ end (left end on plus strand, right end on minus strand). A negative coordinate is counted from the 3’ end (for example -1 is the last nucleotide). end=None means “up to the 3’ end”.
- Parameters:
start (int or 1-D array-like of int, default 0) – Inclusive start offset.
end (int or 1-D array-like of int or None, default None) – Exclusive end offset. None means the existing 3’ end.
group_by (str or list of str, optional) – Column name(s) that define groups (for example exons in one transcript). If given, slicing is performed on the spliced transcript; introns are ignored unless count_introns is True.
use_strand ({"auto", True, False}, default "auto") – If True the 5’/3’ logic honours the strand column. If False every interval is treated as plus strand. “auto” selects True when the PyRanges has valid strand information.
count_introns (bool, default False) – If False (default) start and end refer to spliced coordinates (introns ignored). If True they refer to unspliced coordinates.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
A new PyRanges object with the requested sub-intervals.
- Return type:
Notes
Out-of-bounds requests are silently truncated to the existing span.
Negative offsets are resolved after the transcript length is known, so they always count from the 3’ end of the (spliced or unspliced) interval in question.
See also
PyRanges.window_rangesdivide intervals into windows
Examples
>>> p = pr.PyRanges({"Chromosome": [1, 1, 2, 2, 3], ... "Strand": ["+", "+", "-", "-", "+"], ... "Start": [1, 40, 10, 70, 140], ... "End": [11, 60, 25, 80, 152], ... "transcript_id":["t1", "t1", "t2", "t2", "t3"] }) >>> p index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 40 60 t1 2 | 2 - 10 25 t2 3 | 2 - 70 80 t2 4 | 3 + 140 152 t3 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Get the first 5 nucleotides of each interval, counting from the 5’ end:
>>> p.slice_ranges(0, 5) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 6 t1 1 | 1 + 40 45 t1 2 | 2 - 20 25 t2 3 | 2 - 75 80 t2 4 | 3 + 140 145 t3 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Get the last 10 nucleotides of each interval. End is omitted to get the existing 3’ end:
>>> p.slice_ranges(-10) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 50 60 t1 2 | 2 - 10 20 t2 3 | 2 - 70 80 t2 4 | 3 + 142 152 t3 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Get the first 15 nucleotides of each spliced transcript, grouping exons by transcript_id:
>>> p.slice_ranges(0, 15, group_by='transcript_id') index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 40 45 t1 2 | 2 - 20 25 t2 3 | 2 - 70 80 t2 4 | 3 + 140 152 t3 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Get the last 20 nucleotides of each spliced transcript:
>>> p.slice_ranges(-20, group_by='transcript_id') index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 1 | 1 + 40 60 t1 2 | 2 - 10 25 t2 3 | 2 - 70 75 t2 4 | 3 + 140 152 t3 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Use use_strand=False to treat all intervals as if they were on the + strand:
>>> p.slice_ranges(0, 15, group_by='transcript_id', use_strand=False) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 40 45 t1 2 | 2 - 10 25 t2 4 | 3 + 140 152 t3 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Get region from 25 to 60 of each spliced transcript, or their existing subportion:
>>> p.slice_ranges(25, 60, group_by='transcript_id') index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 1 | 1 + 55 60 t1 PyRanges with 1 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 1 strands.
Get region of each spliced transcript which excludes their first and last 3 nucleotides:
>>> p.slice_ranges(3, -3, group_by='transcript_id') index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 4 11 t1 1 | 1 + 40 57 t1 2 | 2 - 13 25 t2 3 | 2 - 70 77 t2 4 | 3 + 143 149 t3 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Considering input start,end to refer to the unspliced transcript, i.e. counting introns. This fetches all interval portions that overlap with the first 50nt of each transcript:
>>> p.slice_ranges(0, 50, group_by='transcript_id', count_introns=True) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 40 51 t1 3 | 2 - 70 80 t2 4 | 3 + 140 152 t3 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
>>> p.slice_ranges(0, 50, group_by='transcript_id', count_introns=True, use_strand=False) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 1 11 t1 1 | 1 + 40 51 t1 2 | 2 - 10 25 t2 4 | 3 + 140 152 t3 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
>>> p.slice_ranges(-50, -5, group_by='transcript_id', count_introns=True) index | Chromosome Strand Start End transcript_id int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | 1 + 10 11 t1 1 | 1 + 40 55 t1 2 | 2 - 15 25 t2 4 | 3 + 140 147 t3 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
- sort_ranges(by: str | Iterable[str] | None = None, *, natsort: bool = True, use_strand: Literal['auto'] | bool = 'auto', sort_descending: str | Iterable[str] | None = None) PyRanges
Sort PyRanges according to Chromosome, Strand (if present), Start, and End; or by the specified columns.
If PyRanges is stranded and use_strand is True, intervals on the negative strand are sorted in descending order, and End is considered before Start. This is to have a 5’ to 3’ order. For uses not covered by this function, use DataFrame.sort_values().
The full key list is Chromosome, Strand, *by, Start, End, and any column you name in
byis taken out of its implicit position and used where you put it. Soby=["Strand", "Chromosome"]sorts by strand first, andby=["Start", "End", "score"]putsscoreafter the coordinates. The rule applies per column, so name every key you care about:by=["score", "Chromosome"]gives Strand, score, Chromosome, Start, End.- Parameters:
by (str or list of str, default None) – If provided, sorting occurs by Chromosome, Strand (if present), *by, Start, and End.
use_strand ({"auto", True, False}, default: "auto") –
Whether negative strand intervals should be sorted in descending order, meaning 5’ to 3’. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
Note this does not control whether Strand is a sort key: it always is, when the column exists. use_strand=False only stops negative-strand rows being ordered 3’ to 5’. To sort without grouping by strand, drop or rename the column.
natsort (bool, default True) – Whether to use natural sorting for string columns, so that e.g. chr2 < chr11.
sort_descending (str or list of str, default None) – Keys to sort in reverse. Every name must be one of the sort keys, the implicit Chromosome, Strand, Start and End included; a name that is not raises ValueError. On the coordinate keys this composes with use_strand by XOR, so a reversed row and a reversed key cancel out.
- Returns:
Sorted PyRanges. The index is preserved. Use .reset_index(drop=True) to reset the index.
- Return type:
Examples
>>> p = pr.PyRanges({"Chromosome": ["chr1", "chr1", "chr1", "chr1", "chr2", "chr11", "chr11", "chr1"], ... "Strand": ["+", "+", "-", "-", "+", "+", "+", "+"], ... "Start": [40, 1, 10, 70, 300, 140, 160, 90], ... "End": [60, 11, 25, 80, 400, 152, 190, 100], ... "transcript_id":["t3", "t3", "t2", "t2", "t4", "t5", "t5", "t1"]}) >>> p index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 0 | chr1 + 40 60 t3 1 | chr1 + 1 11 t3 2 | chr1 - 10 25 t2 3 | chr1 - 70 80 t2 4 | chr2 + 300 400 t4 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 7 | chr1 + 90 100 t1 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
>>> p.sort_ranges(natsort=False) index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 7 | chr1 + 90 100 t1 3 | chr1 - 70 80 t2 2 | chr1 - 10 25 t2 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 4 | chr2 + 300 400 t4 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Do not sort negative strand intervals in descending order:
>>> p.sort_ranges(use_strand=False, natsort=False) index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 7 | chr1 + 90 100 t1 2 | chr1 - 10 25 t2 3 | chr1 - 70 80 t2 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 4 | chr2 + 300 400 t4 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Sort chromosomes in natural order:
>>> p.sort_ranges() index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 7 | chr1 + 90 100 t1 3 | chr1 - 70 80 t2 2 | chr1 - 10 25 t2 4 | chr2 + 300 400 t4 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Sort by ‘transcript_id’ before than by columns Start and End (but after Chromosome and Strand):
>>> p.sort_ranges(by='transcript_id', natsort=False) index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 7 | chr1 + 90 100 t1 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 3 | chr1 - 70 80 t2 2 | chr1 - 10 25 t2 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 4 | chr2 + 300 400 t4 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Sort by ‘transcript_id’ before than by columns Strand, Start and End:
>>> res = p.sort_ranges(natsort=False) >>> res.sort_values("transcript_id", kind="stable") index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 7 | chr1 + 90 100 t1 3 | chr1 - 70 80 t2 2 | chr1 - 10 25 t2 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 4 | chr2 + 300 400 t4 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
Same as before, but ‘transcript_id’ is sorted in descending order:
>>> res = p.sort_ranges(natsort=False) >>> res.sort_values("transcript_id", kind="stable", ascending=False) index | Chromosome Strand Start End transcript_id int64 | str str int64 int64 str ------- --- ------------ -------- ------- ------- --------------- 5 | chr11 + 140 152 t5 6 | chr11 + 160 190 t5 4 | chr2 + 300 400 t4 1 | chr1 + 1 11 t3 0 | chr1 + 40 60 t3 3 | chr1 - 70 80 t2 2 | chr1 - 10 25 t2 7 | chr1 + 90 100 t1 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 3 chromosomes and 2 strands.
- split_overlaps(use_strand: Literal['auto'] | bool = 'auto', *, match_by: str | Iterable[str] | None = None, between: bool = False) PyRanges
Split into non-overlapping intervals.
The output does not contain overlapping intervals, but intervals that are adjacent are not merged. Every output interval descends from an input interval and keeps its metadata. With
between=Truethe gap intervals descend from no input row, so only the location columns are output;Strandis among them only when it was a grouping key.- Parameters:
use_strand ({"auto", True, False}, default: "auto") – Whether to split only intervals on the same strand. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
between (bool, default False) – Output also intervals corresponding to the gaps between the intervals in self.
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be split.
- Returns:
PyRanges with intervals split at overlap points.
- Return type:
See also
PyRanges.merge_overlapsmerge overlapping intervals
PyRanges.max_disjoint_overlapsfind the maximal disjoint set of intervals
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1', 'chr1', 'chr1'], 'Start': [3, 5, 5, 11], ... 'End': [6, 9, 7, 12], 'Strand': ['+', '+', '-', '-']}) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 3 6 + 1 | chr1 5 9 + 2 | chr1 5 7 - 3 | chr1 11 12 - PyRanges with 4 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.split_overlaps() index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 3 5 + 1 | chr1 5 6 + 2 | chr1 6 9 + 3 | chr1 5 7 - 4 | chr1 11 12 - PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.split_overlaps(between=True) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 3 5 + 1 | chr1 5 6 + 2 | chr1 6 9 + 3 | chr1 5 7 - 4 | chr1 7 11 - 5 | chr1 11 12 - PyRanges with 6 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.split_overlaps(use_strand=False) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 3 5 + 1 | chr1 5 6 + 2 | chr1 6 7 + 3 | chr1 7 9 - 4 | chr1 11 12 - PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.split_overlaps(use_strand=False, between=True) index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 3 5 1 | chr1 5 6 2 | chr1 6 7 3 | chr1 7 9 4 | chr1 9 11 5 | chr1 11 12 PyRanges with 6 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr['ID'] = ['a', 'b', 'a', 'c'] >>> gr index | Chromosome Start End Strand ID int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 0 | chr1 3 6 + a 1 | chr1 5 9 + b 2 | chr1 5 7 - a 3 | chr1 11 12 - c PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.split_overlaps(use_strand=False, match_by='ID') index | Chromosome Start End Strand ID int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 0 | chr1 3 5 + a 1 | chr1 5 6 - a 2 | chr1 6 7 + a 3 | chr1 5 9 + b 4 | chr1 11 12 - c PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- property strand_valid: bool
Whether PyRanges has valid strand info.
Values other than ‘+’ and ‘-’ in the Strand column are not considered valid. A PyRanges without a Strand column is also not considered to have valid strand info.
See also
PyRanges.has_strandwhether a Strand column is present
PyRanges.make_strand_validmake the strand information in PyRanges valid
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1'], 'Start': [1, 6], ... 'End': [5, 8], 'Strand': ['+', '.']}) >>> gr index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 1 5 + 1 | chr1 6 8 . PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands (including non-genomic strands: .). >>> gr.strand_valid # invalid strand value: '.' False
>>> "Strand" in gr.columns True
- subtract_overlaps(other: PyRanges, strand_behavior: Literal['auto', 'same', 'opposite', 'ignore'] = 'auto', *, match_by: str | Iterable[str] | None = None, preserve_input_order: bool = True) PyRanges
Subtract intervals, i.e. return non-overlapping subintervals.
Identify intervals in other that overlap with intervals in self; return self with the overlapping parts removed.
- Parameters:
other – PyRanges to subtract.
strand_behavior ("auto", "same", "opposite", "ignore") – How to handle strand information. “auto” means use “same” if both PyRanges are stranded, otherwise ignore the strand information. “same” means only subtract intervals on the same strand. “opposite” means only subtract intervals on the opposite strand. “ignore” means ignore strand
match_by (str or list, default None) – If provided, only intervals with an equal value in column(s) match_by may be considered as overlapping.
preserve_input_order (bool, default True) –
Whether to preserve the original input order in the result.
If False, rows may be returned in algorithm/output order instead, which can be faster for large results.
- Returns:
PyRanges with subintervals from self that do not overlap with any interval in other. Columns and index are preserved.
- Return type:
Warning
The returned Pyranges may have index duplicates. Call .reset_index(drop=True) to fix it.
See also
PyRanges.overlapuse with invert=True to return all intervals without overlap
PyRanges.complement_rangesreturn the internal complement of intervals, i.e. its introns.
Examples
>>> gr = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [1, 4, 10], ... "End": [3, 9, 11], "ID": ["a", "b", "c"]}) >>> gr2 = pr.PyRanges({"Chromosome": ["chr1"] * 3, "Start": [2, 2, 9], "End": [3, 9, 10]}) >>> gr index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 3 a 1 | chr1 4 9 b 2 | chr1 10 11 c PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr2 index | Chromosome Start End int64 | str int64 int64 ------- --- ------------ ------- ------- 0 | chr1 2 3 1 | chr1 2 9 2 | chr1 9 10 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.subtract_overlaps(gr2) index | Chromosome Start End ID int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 1 2 a 2 | chr1 10 11 c PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr['tag'] = ['x', 'y', 'z'] >>> gr2['tag'] = ['x', 'w', 'z'] >>> gr index | Chromosome Start End ID tag int64 | str int64 int64 str str ------- --- ------------ ------- ------- ----- ----- 0 | chr1 1 3 a x 1 | chr1 4 9 b y 2 | chr1 10 11 c z PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr2 index | Chromosome Start End tag int64 | str int64 int64 str ------- --- ------------ ------- ------- ----- 0 | chr1 2 3 x 1 | chr1 2 9 w 2 | chr1 9 10 z PyRanges with 3 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.subtract_overlaps(gr2, match_by="tag") index | Chromosome Start End ID tag int64 | str int64 int64 str str ------- --- ------------ ------- ------- ----- ----- 0 | chr1 1 2 a x 1 | chr1 4 9 b y 2 | chr1 10 11 c z PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes.
- summary(*, return_df: bool = False) DataFrame | None
Return a summary of info regarding this PyRanges object.
In output, the row “count” refers to thenumber of intervals and “sum” to their total length. The rest describe the distribution of lengths of the intervals.
The column “pyrange” describes the data as is. “coverage_forward” and “coverage_reverse” describe the data after strand-specific merging of overlapping intervals. “coverage_unstranded” describes the data after merging, without considering the strands.
- Parameters:
return_df (bool, default False) – Return df with summary.
- Return type:
None or pd.DataFrame with summary.
Examples
>>> gr = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_id"]) >>> gr index | Chromosome Start End Strand Feature gene_id int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- --------------- 0 | 1 11868 14409 + gene ENSG00000223972 1 | 1 11868 14409 + transcript ENSG00000223972 2 | 1 11868 12227 + exon ENSG00000223972 3 | 1 12612 12721 + exon ENSG00000223972 ... | ... ... ... ... ... ... 7 | 1 120724 133723 - transcript ENSG00000238009 8 | 1 133373 133723 - exon ENSG00000238009 9 | 1 129054 129223 - exon ENSG00000238009 10 | 1 120873 120932 - exon ENSG00000238009 PyRanges with 11 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.summary() pyrange coverage_forward coverage_reverse coverage_unstranded ----- --------- ------------------ ------------------ --------------------- count 11 1 3 4 mean 1893.27 2541 4503 4012.5 std 3799.24 nan 7359.28 6088.38 min 59 2541 105 105 25% 139 2541 255 330 50% 359 2541 405 1473 75% 1865 2541 6702 5155.5 max 12999 2541 12999 12999 sum 20826 2541 13509 16050
>>> gr.summary(return_df=True) pyrange coverage_forward coverage_reverse coverage_unstranded count 11.000000 1.0 3.000000 4.000000 mean 1893.272727 2541.0 4503.000000 4012.500000 std 3799.238610 NaN 7359.280671 6088.379834 min 59.000000 2541.0 105.000000 105.000000 25% 139.000000 2541.0 255.000000 330.000000 50% 359.000000 2541.0 405.000000 1473.000000 75% 1865.000000 2541.0 6702.000000 5155.500000 max 12999.000000 2541.0 12999.000000 12999.000000 sum 20826.000000 2541.0 13509.000000 16050.000000
- three_end(group_by: str | Iterable[str] | None = None, ext: int = 0) PyRanges
Return the three prime end of intervals.
The three prime end is the end of a forward strand or the start of a reverse strand. All returned intervals have length of 1.
- Parameters:
group_by (str or list of str, default: None) – Optional column name(s). If provided, the three prime end is calculated for each group of intervals (e.g. for each transcript).
ext (int, default 0) – Lengthen the resulting intervals on both ends by this amount.
- Returns:
PyRanges with the three prime ends
- Return type:
See also
PyRanges.upstreamreturn regions upstream of input intervals or transcripts
PyRanges.five_endreturn the 5’ end of intervals or transcripts
PyRanges.extend_rangesreturn intervals or transcripts extended at one or both ends
Examples
>>> gr = pr.PyRanges({'Chromosome': ['chr1', 'chr1', 'chr1'], 'Start': [3, 10, 5], 'End': [9, 14, 7], ... 'Strand': ["+", "+", "-"], 'Name': ['a', 'a', 'b']}) >>> gr index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 3 9 + a 1 | chr1 10 14 + a 2 | chr1 5 7 - b PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.three_end() index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 0 | chr1 8 9 + a 1 | chr1 13 14 + a 2 | chr1 5 6 - b PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.three_end(group_by='Name') index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 1 | chr1 13 14 + a 2 | chr1 5 6 - b PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.three_end(group_by='Name', ext=1) index | Chromosome Start End Strand Name int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ------ 1 | chr1 12 15 + a 2 | chr1 4 7 - b PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
- tile_ranges(tile_size: int, *, use_strand: Literal['auto'] | bool = False, match_by: str | Iterable[str] | None = None, overlap_column: str | None = None) PyRanges
Return overlapping genomic tiles.
The genome is divided into bookended tiles of length tile_size. One tile is returned for each interval that overlaps with it, including any metadata from the original intervals.
- Parameters:
tile_size (int) – Length of the tiles.
overlap_column (str, default None) – Name of column to add with the overlap between each bookended tile.
use_strand ({"auto", True, False}, default: "auto") – Whether negative strand intervals should be windowed in reverse order. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
match_by (str | Sequence[str] | None, default None) – Column name(s) used to form groups when iterating rows. For tile, grouping does not change which tiles are produced or their overlap fractions: tiles are always taken from a fixed genomic grid with step tile_size (boundaries at multiples of tile_size), and each interval is intersected with that grid independently. Group boundaries only affect iteration order; there is no cross-interval “carry” for tile.
- Returns:
Tiled PyRanges.
- Return type:
Warning
The returned Pyranges may have index duplicates. Call .reset_index(drop=True) to fix it.
See also
PyRanges.window_rangesdivide intervals into windows
pyranges.tile_genomedivide the genome into tiles
Examples
>>> gr = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_name"]) >>> gr index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 0 | 1 11868 14409 + gene DDX11L1 1 | 1 11868 14409 + transcript DDX11L1 2 | 1 11868 12227 + exon DDX11L1 3 | 1 12612 12721 + exon DDX11L1 ... | ... ... ... ... ... ... 7 | 1 120724 133723 - transcript AL627309.1 8 | 1 133373 133723 - exon AL627309.1 9 | 1 129054 129223 - exon AL627309.1 10 | 1 120873 120932 - exon AL627309.1 PyRanges with 11 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.tile_ranges(200) index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 0 | 1 11800 12000 + gene DDX11L1 0 | 1 12000 12200 + gene DDX11L1 0 | 1 12200 12400 + gene DDX11L1 0 | 1 12400 12600 + gene DDX11L1 ... | ... ... ... ... ... ... 8 | 1 133600 133800 - exon AL627309.1 9 | 1 129000 129200 - exon AL627309.1 9 | 1 129200 129400 - exon AL627309.1 10 | 1 120800 121000 - exon AL627309.1 PyRanges with 116 rows, 6 columns, and 1 index columns (with 105 index duplicates). Contains 1 chromosomes and 2 strands.
>>> gr.tile_ranges(100, overlap_column="TileOverlap") index | Chromosome Start End Strand Feature gene_name TileOverlap int64 | category int64 int64 category category str float64 ------- --- ------------ ------- ------- ---------- ---------- ----------- ------------- 0 | 1 11800 11900 + gene DDX11L1 0.32 0 | 1 11900 12000 + gene DDX11L1 1.0 0 | 1 12000 12100 + gene DDX11L1 1.0 0 | 1 12100 12200 + gene DDX11L1 1.0 ... | ... ... ... ... ... ... ... 9 | 1 129100 129200 - exon AL627309.1 1.0 9 | 1 129200 129300 - exon AL627309.1 0.23 10 | 1 120800 120900 - exon AL627309.1 0.27 10 | 1 120900 121000 - exon AL627309.1 0.32 PyRanges with 223 rows, 7 columns, and 1 index columns (with 212 index duplicates). Contains 1 chromosomes and 2 strands.
- to_bed(path: str | None = None, compression: Literal['infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'] | dict[str, Any] | None = 'infer', *, keep: bool = True) str | None
Write to bed.
- Parameters:
path (str, default None) – Where to write. If None, returns string representation.
keep (bool, default True) – Whether to keep all columns, not just Chromosome, Start, End, Name, Score, Strand when writing.
compression ({'infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'}, default "infer") – Which compression to use. The default infers it from the file extension, and
Noneis treated the same way: writing to a.gzpath always produces gzip. See pandas.DataFrame.to_csv for more info.
Examples
>>> d = {'Chromosome': ['chr1', 'chr1'], 'Start': [1, 6], ... 'End': [5, 8], 'Strand': ['+', '-'], "Gene": [1, 2]} >>> gr = pr.PyRanges(d) >>> gr index | Chromosome Start End Strand Gene int64 | str int64 int64 str int64 ------- --- ------------ ------- ------- -------- ------- 0 | chr1 1 5 + 1 1 | chr1 6 8 - 2 PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.to_bed() 'chr1\t1\t5\t.\t.\t+\t1\nchr1\t6\t8\t.\t.\t-\t2\n'
File contents:
chr1 1 5 . . + 1 chr1 6 8 . . - 2
Does not include noncanonical bed-column Gene:
>>> gr.to_bed(keep=False) 'chr1\t1\t5\t.\t.\t+\nchr1\t6\t8\t.\t.\t-\n'
File contents:
chr1 1 5 . . + chr1 6 8 . . -
>>> gr.to_bed("test.bed")
>>> open("test.bed").readlines() ['chr1\t1\t5\t.\t.\t+\t1\n', 'chr1\t6\t8\t.\t.\t-\t2\n']
- to_bigwig(path: None = None, chromosome_sizes: DataFrame | dict | None = None, value_col: str | None = None, *, divide: bool = False, rpm: bool = True, precomputed: bool = False, return_data=False) PyRanges | None
Compute coverage (interval-based, or using a numerical value column) and write to bigwig.
Computes a score per position; by default, it is the number of intervals spanning that position. If value_col is provided, the score is the sum of values of all intervals spanning that position. The score per position is then reduced to a minimal number of ranges with constant coverage (i.e. like a run-length encoding), and written in bigwig format to the provided path.
With
precomputed=True, skip coverage computation and write each input range with its value fromvalue_col; with this option, input ranges must be non-overlapping.Note
To create one bigwig per strand, subset the PyRanges first into two separate objects (positive and negative strands).
- Parameters:
path (str | None, default None) – Where to write bigwig. If None, return_data must be True.
chromosome_sizes (PyRanges or dict or None, default None) – Chromosome sizes to use. If provided, the output bigwig will span the entire chromosomes as given here. If dict, it must be a map of chromosome names to chromosome length. If a PyRanges, it must have ‘Chromosome’ and ‘End’ columns, where ‘End’ gives the chromosome length. If None, the maximum end position per chromosome in the input PyRanges is used.
value_col (str, default None) – Name of column to compute coverage of. If None, compute coverage (i.e. number of intervals spanning each position). Required when
precomputed=True; in that mode, its values are written directly.divide (bool, default False) – (Only useful with value_col) Divide value coverage by regular coverage and take log2. Incompatible with
precomputed=True.rpm (bool, default True) – Whether to normalize data by dividing by total number of intervals and multiplying by 1e6. Ignored when
precomputed=True.precomputed (bool, default False) – Write the ranges and
value_colvalues directly, without computing coverage.rpmis ignored in this mode. The ranges must be non-overlapping (ignoring strand). To check, use:assert len(gr.max_disjoint_overlaps(use_strand=False)) == len(gr)return_data (bool, default False) – Whether to return the data that would be written to bigwig as a PyRanges.
Note
Requires pybigwig and pyrle to be installed.
Examples
>>> d = {'Chromosome': ['chr1', 'chr1', 'chr1'], 'Start': [1, 4, 6], ... 'End': [7, 8, 10], 'Strand': ['+', '-', '-'], ... 'Value': [10, 20, 30]} >>> gr = pr.PyRanges(d) >>> gr index | Chromosome Start End Strand Value int64 | str int64 int64 str int64 ------- --- ------------ ------- ------- -------- ------- 0 | chr1 1 7 + 10 1 | chr1 4 8 - 20 2 | chr1 6 10 - 30 PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr.to_bigwig(return_data=True, rpm=False) index | Chromosome Start End Score int64 | category int64 int64 float64 ------- --- ------------ ------- ------- --------- 1 | chr1 1 4 1 2 | chr1 4 6 2 3 | chr1 6 7 3 4 | chr1 7 8 2 5 | chr1 8 10 1 PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.to_bigwig(return_data=True, rpm=False, value_col="Value") index | Chromosome Start End Score int64 | category int64 int64 float64 ------- --- ------------ ------- ------- --------- 1 | chr1 1 4 10 2 | chr1 4 6 30 3 | chr1 6 7 60 4 | chr1 7 8 50 5 | chr1 8 10 30 PyRanges with 5 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.to_bigwig(return_data=True, rpm=False, value_col="Value", divide=True) index | Chromosome Start End Score int64 | category int64 int64 float64 ------- --- ------------ ------- ------- --------- 0 | chr1 0 1 nan 1 | chr1 1 4 3.32193 2 | chr1 4 6 3.90689 3 | chr1 6 7 4.32193 4 | chr1 7 8 4.64386 5 | chr1 8 10 4.90689 PyRanges with 6 rows, 4 columns, and 1 index columns. Contains 1 chromosomes.
Write already-computed, non-overlapping values directly:
>>> signal = pr.PyRanges({"Chromosome": ["chr1", "chr1"], ... "Start": [1, 6], "End": [4, 9], "Value": [0.5, 1.5]}) >>> signal.to_bigwig("signal.bw", {"chr1": 10}, value_col="Value", precomputed=True)
- to_gff3(path: None = None, compression: Literal['infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'] | dict[str, Any] | None = 'infer', map_cols: dict | None = None) str | None
Write to General Feature Format 3.
The GFF format consists of a tab-separated file without header. GFF contains a fixed amount of columns, indicated below (names before “:”). For each of these, PyRanges will use the corresponding column (names after “:”).
seqname: Chromosome
source: Source
feature: Feature
start: Start
end: End
score: Score
strand: Strand
phase: Frame
attribute: auto-filled
Columns which are not mapped to GFF columns are appended as a field in the
attributestring (i.e. the last field).- Parameters:
path (str, default None, i.e. return string representation.) – Where to write file.
compression ({'infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'}, default "infer") – Which compression to use. The default infers it from the file extension, and
Noneis treated the same way: writing to a.gzpath always produces gzip.map_cols (dict, default None) – Override mapping between GTF and PyRanges fields for any number of columns. Format:
{gtf_column : pyranges_column}If a mapping is found for the “attribute”` column, it is not auto-filled
Note
Nonexisting columns will be added with a ‘.’ to represent the missing values.
See also
pyranges.read_gff3read GFF3 files
pyranges.to_gtfwrite to GTF format
Examples
>>> d = {"Chromosome": [1] * 3, "Start": [1, 3, 5], "End": [4, 6, 9], "Feature": ["gene", "exon", "exon"]} >>> gr = pr.PyRanges(d) >>> gr.to_gff3() '1\t.\tgene\t2\t4\t.\t.\t.\t\n1\t.\texon\t4\t6\t.\t.\t.\t\n1\t.\texon\t6\t9\t.\t.\t.\t\n'
How the file would look:
1 . gene 2 4 . . . 1 . exon 4 6 . . . 1 . exon 6 9 . . .
>>> gr["Gene"] = [1, 2, 3] >>> gr["function"] = ["a b", "c", "def"] >>> gr.to_gff3() '1\t.\tgene\t2\t4\t.\t.\t.\tGene=1;function=a b\n1\t.\texon\t4\t6\t.\t.\t.\tGene=2;function=c\n1\t.\texon\t6\t9\t.\t.\t.\tGene=3;function=def\n'
How the file would look:
1 . gene 2 4 . . . Gene=1;function=a b 1 . exon 4 6 . . . Gene=2;function=c 1 . exon 6 9 . . . Gene=3;function=def
>>> gr["phase"] = [0, 2, 1] >>> gr["Feature"] = ['mRNA', 'CDS', 'CDS'] >>> gr index | Chromosome Start End Feature Gene function phase int64 | int64 int64 int64 str int64 str int64 ------- --- ------------ ------- ------- --------- ------- ---------- ------- 0 | 1 1 4 mRNA 1 a b 0 1 | 1 3 6 CDS 2 c 2 2 | 1 5 9 CDS 3 def 1 PyRanges with 3 rows, 7 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.to_gff3() '1\t.\tmRNA\t2\t4\t.\t.\t0\tGene=1;function=a b\n1\t.\tCDS\t4\t6\t.\t.\t2\tGene=2;function=c\n1\t.\tCDS\t6\t9\t.\t.\t1\tGene=3;function=def\n'
How the file would look:
1 . mRNA 2 4 . . 0 Gene=1;function=a b 1 . CDS 4 6 . . 2 Gene=2;function=c 1 . CDS 6 9 . . 1 Gene=3;function=def
>>> gr['custom'] = ['AA', 'BB', 'CC'] >>> gr index | Chromosome Start End Feature Gene function phase custom int64 | int64 int64 int64 str int64 str int64 str ------- --- ------------ ------- ------- --------- ------- ---------- ------- -------- 0 | 1 1 4 mRNA 1 a b 0 AA 1 | 1 3 6 CDS 2 c 2 BB 2 | 1 5 9 CDS 3 def 1 CC PyRanges with 3 rows, 8 columns, and 1 index columns. Contains 1 chromosomes.
>>> print(gr.to_gff3(map_cols={"feature": "custom"})) 1 . AA 2 4 . . 0 Feature=mRNA;Gene=1;function=a b 1 . BB 4 6 . . 2 Feature=CDS;Gene=2;function=c 1 . CC 6 9 . . 1 Feature=CDS;Gene=3;function=def
>>> print(gr.to_gff3(map_cols={"attribute": "custom"})) 1 . mRNA 2 4 . . 0 AA 1 . CDS 4 6 . . 2 BB 1 . CDS 6 9 . . 1 CC
- to_gtf(path: None = None, compression: Literal['infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'] | dict[str, Any] | None = 'infer', map_cols: dict | None = None) str | None
Write to Gene Transfer Format.
The GTF format consists of a tab-separated file without header. It contains a fixed amount of columns, indicated below (names before “:”). For each of these, PyRanges will use the corresponding column (names after “:”).
seqname: Chromosome
source: Source
feature: Feature
start: Start
end: End
score: Score
strand: Strand
frame: Frame
attribute: auto-filled
Columns which are not mapped to GTF columns are appended as a field in the
attributestring (i.e. the last field).- Parameters:
path (str, default None, i.e. return string representation.) – Where to write file.
compression ({'infer', 'gzip', 'bz2', 'zip', 'xz', 'zstd'}, default "infer") – Which compression to use. The default infers it from the file extension, and
Noneis treated the same way: writing to a.gzpath always produces gzip.map_cols (dict, default None) – Override mapping between GTF and PyRanges fields for any number of columns. Format:
{gtf_column : pyranges_column}If a mapping is found for the “attribute”` column, it is not auto-filled
Note
Nonexisting columns will be added with a ‘.’ to represent the missing values.
See also
pyranges.read_gtfread GTF files
pyranges.to_gff3write to GFF3 format
Examples
>>> d = {"Chromosome": [1] * 3, "Start": [1, 3, 5], "End": [4, 6, 9], "Feature": ["gene", "exon", "exon"]} >>> gr = pr.PyRanges(d) >>> gr.to_gtf() # the raw string output '1\t.\tgene\t2\t4\t.\t.\t.\t\n1\t.\texon\t4\t6\t.\t.\t.\t\n1\t.\texon\t6\t9\t.\t.\t.\t\n'
What the file contents look like:
1 . gene 2 4 . . . 1 . exon 4 6 . . . 1 . exon 6 9 . . .
>>> gr.Feature = ["GENE", "EXON", "EXON"] >>> gr.to_gtf() # the raw string output '1\t.\tGENE\t2\t4\t.\t.\t.\t\n1\t.\tEXON\t4\t6\t.\t.\t.\t\n1\t.\tEXON\t6\t9\t.\t.\t.\t\n'
The file would look like:
1 . GENE 2 4 . . . 1 . EXON 4 6 . . . 1 . EXON 6 9 . . .
>>> gr["tag"] = [11, 22, 33] >>> gr index | Chromosome Start End Feature tag int64 | int64 int64 int64 str int64 ------- --- ------------ ------- ------- --------- ------- 0 | 1 1 4 GENE 11 1 | 1 3 6 EXON 22 2 | 1 5 9 EXON 33 PyRanges with 3 rows, 5 columns, and 1 index columns. Contains 1 chromosomes.
>>> print(gr.to_gff3()) 1 . GENE 2 4 . . . tag=11 1 . EXON 4 6 . . . tag=22 1 . EXON 6 9 . . . tag=33
>>> print(gr.to_gff3(map_cols={'seqname':'tag'})) 11 . GENE 2 4 . . . Chromosome=1 22 . EXON 4 6 . . . Chromosome=1 33 . EXON 6 9 . . . Chromosome=1
>>> print(gr.to_gff3(map_cols={'attribute':'tag'})) 1 . GENE 2 4 . . . 11 1 . EXON 4 6 . . . 22 1 . EXON 6 9 . . . 33
- to_rle(value_col: str | None = None, strand: Literal['auto'] | bool = 'auto', *, rpm: bool = False) Rledict
Return as Rledict.
Create collection of Rles representing the coverage or other numerical value.
- Parameters:
value_col (str, default None) – Numerical column to create Rledict from.
strand (bool, default None, i.e. auto) – Whether to treat strands serparately.
rpm (bool, default False) – Normalize by multiplying with 1e6/(number_intervals).
- Returns:
Rle with coverage or other info from the PyRanges.
- Return type:
pyrle.Rledict
- upstream(length: int, gap: int = 0, *, group_by: str | Iterable[str] | None = None, use_strand: Literal['auto'] | bool = 'auto') PyRanges
Return regions upstream (at the 5’ side) of input intervals.
- Parameters:
length (int) – Size of the region (bp), > 0.
gap (int, default 0) – Distance between region and input intervals; use negative to include some overlap.
group_by (str or list of str or None) – Name(s) of column(s) to group intervals. If provided, one region per group (e.g. transcript) is returned.
use_strand ({"auto", True, False}, default: "auto") – Whether to consider strand; if so, the upstream window of negative intervals is on their right. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
See also
PyRanges.downstreamreturn regions downstream of input intervals or transcripts
PyRanges.five_endreturn the 5’ end of intervals or transcripts
PyRanges.extend_rangesreturn intervals or transcripts extended at one or both ends
PyRanges.slice_rangesobtain subsequences of intervals, providing transcript-level coordinates
Examples
>>> a = pr.PyRanges({'Chromosome':['chr1','chr1'], ... 'Start':[100,200],'End':[120,220], ... 'Strand':['+','-']}) >>> a index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 100 120 + 1 | chr1 200 220 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Default window (10 bp) right at the border:
>>> a.upstream(10) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 90 100 + 1 | chr1 220 230 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
With a 5 bp gap:
>>> a.upstream(10, gap=5) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 85 95 + 1 | chr1 225 235 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
With a 5 bp overlap (negative gap):
>>> a.upstream(10, gap=-5) index | Chromosome Start End Strand int64 | str int64 int64 str ------- --- ------------ ------- ------- -------- 0 | chr1 95 105 + 1 | chr1 215 225 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Transcript-aware example (two 2-exon transcripts):
>>> ex = pr.PyRanges({'Chromosome':['chr1']*4, ... 'Start':[0,10,30,50],'End':[5,15,40,60], ... 'Strand':['+','+','-','-'], ... 'Tx':['tx1','tx1','tx2','tx2']}) >>> ex index | Chromosome Start End Strand Tx int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 0 | chr1 0 5 + tx1 1 | chr1 10 15 + tx1 2 | chr1 30 40 - tx2 3 | chr1 50 60 - tx2 PyRanges with 4 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
Note that upstream regions may extend beyond the start of the chromosome, resulting in invalid ranges. See clip_ranges() to fix this.
>>> ex.upstream(5, group_by='Tx') index | Chromosome Start End Strand Tx int64 | str int64 int64 str str ------- --- ------------ ------- ------- -------- ----- 0 | chr1 -5 0 + tx1 3 | chr1 60 65 - tx2 PyRanges with 2 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands. Invalid ranges: * 1 starts or ends are < 0. See indexes: 0
- window_ranges(window_size: int, use_strand: Literal['auto'] | bool = 'auto', group_by: str | Iterable[str] | None = None, *, add_window_id: bool = False) PyRanges
Return intervals sliced in non-overlapping windows.
Every interval is split into windows of length window_size starting from its 5’ end.
- Parameters:
window_size (int) – Length of the windows.
use_strand ({"auto", True, False}, default: "auto") – Whether negative strand intervals should be sliced in descending order, meaning 5’ to 3’. The default “auto” means True if PyRanges has valid strands (see .strand_valid).
group_by (str | Sequence[str] | None, default None) – Column name(s) used to form groups. If provided, windowing proceeds continuously within each group: any leftover (partial) window at the end of one interval is continued at the start of the next interval with the same group_by value. The window “phase” resets at group boundaries.
add_window_id (bool, default False) – Use only in combination with group_by. If True, adds a column “window_id” with an index-like identifier to link the windows split in non-contigous intervals, e.g. because a certain window spans an intron. The window_id starts at 0, and resets for each group.
- Returns:
Sliding window PyRanges.
- Return type:
Warning
The returned Pyranges may have index duplicates. Call .reset_index(drop=True) to fix it. Moreover, the input row order may not be preserved.
See also
PyRanges.tile_rangesdivide intervals into adjacent tiles.
Examples
>>> import pyranges1 as pr >>> gr = pr.PyRanges({"Chromosome": [1], "Start": [800], "End": [1012]}) >>> gr index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 800 1012 PyRanges with 1 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
>>> gr.window_ranges(100) index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 800 900 0 | 1 900 1000 0 | 1 1000 1012 PyRanges with 3 rows, 3 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes.
>>> gr.window_ranges(100).reset_index(drop=True) index | Chromosome Start End int64 | int64 int64 int64 ------- --- ------------ ------- ------- 0 | 1 800 900 1 | 1 900 1000 2 | 1 1000 1012 PyRanges with 3 rows, 3 columns, and 1 index columns. Contains 1 chromosomes.
Negative strand intervals are sliced in descending order by default:
>>> gs = pr.PyRanges({"Chromosome": [1, 1], "Start": [200, 600], "End": [332, 787], "Strand":['+', '-']}) >>> gs index | Chromosome Start End Strand int64 | int64 int64 int64 str ------- --- ------------ ------- ------- -------- 0 | 1 200 332 + 1 | 1 600 787 - PyRanges with 2 rows, 4 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> w = gs.window_ranges(100) >>> w['lengths'] = w.lengths() # add lengths column to see the length of the windows >>> w index | Chromosome Start End Strand lengths int64 | int64 int64 int64 str int64 ------- --- ------------ ------- ------- -------- --------- 0 | 1 200 300 + 100 0 | 1 300 332 + 32 1 | 1 687 787 - 100 1 | 1 600 687 - 87 PyRanges with 4 rows, 5 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
>>> gs.window_ranges(100, use_strand=False) index | Chromosome Start End Strand int64 | int64 int64 int64 str ------- --- ------------ ------- ------- -------- 0 | 1 200 300 + 0 | 1 300 332 + 1 | 1 600 700 - 1 | 1 700 787 - PyRanges with 4 rows, 4 columns, and 1 index columns (with 2 index duplicates). Contains 1 chromosomes and 2 strands.
>>> gr2 = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_name"]) >>> gr2 index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 0 | 1 11868 14409 + gene DDX11L1 1 | 1 11868 14409 + transcript DDX11L1 2 | 1 11868 12227 + exon DDX11L1 3 | 1 12612 12721 + exon DDX11L1 ... | ... ... ... ... ... ... 7 | 1 120724 133723 - transcript AL627309.1 8 | 1 133373 133723 - exon AL627309.1 9 | 1 129054 129223 - exon AL627309.1 10 | 1 120873 120932 - exon AL627309.1 PyRanges with 11 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr2 = pr.example_data.ensembl_gtf.get_with_loc_columns(["Feature", "gene_name"]) >>> gr2.window_ranges(1000) index | Chromosome Start End Strand Feature gene_name int64 | category int64 int64 category category str ------- --- ------------ ------- ------- ---------- ---------- ----------- 0 | 1 11868 12868 + gene DDX11L1 0 | 1 12868 13868 + gene DDX11L1 0 | 1 13868 14409 + gene DDX11L1 1 | 1 11868 12868 + transcript DDX11L1 ... | ... ... ... ... ... ... 7 | 1 120724 121723 - transcript AL627309.1 8 | 1 133373 133723 - exon AL627309.1 9 | 1 129054 129223 - exon AL627309.1 10 | 1 120873 120932 - exon AL627309.1 PyRanges with 28 rows, 6 columns, and 1 index columns (with 17 index duplicates). Contains 1 chromosomes and 2 strands.
>>> gr3 = pr.PyRanges({'Chromosome':1, 'Strand':list('+++--'), 'Start':[10, 30, 50, 70, 90], 'End':[20, 40, 60, 80, 100], 'ID':list('aaabb')}) >>> gr3 index | Chromosome Strand Start End ID int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- ----- 0 | 1 + 10 20 a 1 | 1 + 30 40 a 2 | 1 + 50 60 a 3 | 1 - 70 80 b 4 | 1 - 90 100 b PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr3.window_ranges(8, group_by='ID') index | Chromosome Strand Start End ID int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- ----- 0 | 1 + 10 18 a 0 | 1 + 18 20 a 1 | 1 + 30 36 a 1 | 1 + 36 40 a ... | ... ... ... ... ... 3 | 1 - 74 80 b 3 | 1 - 70 74 b 4 | 1 - 92 100 b 4 | 1 - 90 92 b PyRanges with 10 rows, 5 columns, and 1 index columns (with 5 index duplicates). Contains 1 chromosomes and 2 strands.
>>> gr4 = pr.PyRanges({'Chromosome':2, 'Strand':list('+++--'), 'Start':[30,10,50,90,70], ... 'End':[40,20,60,100,80], 'ID':['id1','id1','id1','id2','id2']}) >>> gr4 index | Chromosome Strand Start End ID int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- ----- 0 | 2 + 30 40 id1 1 | 2 + 10 20 id1 2 | 2 + 50 60 id1 3 | 2 - 90 100 id2 4 | 2 - 70 80 id2 PyRanges with 5 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr4.window_ranges(8, group_by='ID').reset_index(drop=True).head(8) index | Chromosome Strand Start End ID int64 | int64 str int64 int64 str ------- --- ------------ -------- ------- ------- ----- 0 | 2 + 10 18 id1 1 | 2 + 18 20 id1 2 | 2 + 30 36 id1 3 | 2 + 36 40 id1 4 | 2 + 50 54 id1 5 | 2 + 54 60 id1 6 | 2 - 74 80 id2 7 | 2 - 70 74 id2 PyRanges with 8 rows, 5 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.
>>> gr4.window_ranges(8, group_by='ID', add_window_id=True).reset_index(drop=True).head(8) index | Chromosome Strand Start End ID window_id int64 | int64 str int64 int64 str int64 ------- --- ------------ -------- ------- ------- ----- ----------- 0 | 2 + 10 18 id1 1 1 | 2 + 18 20 id1 2 2 | 2 + 30 36 id1 2 3 | 2 + 36 40 id1 3 4 | 2 + 50 54 id1 3 5 | 2 + 54 60 id1 4 6 | 2 - 74 80 id2 1 7 | 2 - 70 74 id2 2 PyRanges with 8 rows, 6 columns, and 1 index columns. Contains 1 chromosomes and 2 strands.