Tutorial

PyRanges objects represent sequence intervals (“ranges”) such as genomic regions. Examples include gene annotations, mapped reads, protein domains, and results from Blast or analogous software. Pyranges provides convenient methods to load data in GFF, GTF, BED, BAM format. In this tutorial, we refer to PyRanges objects for their typical use case, i.e. representing genomic intervals, but the same concepts and methods may be applied to RNA or protein sequences.

Every interval in a PyRanges object is defined, at minimum, by its chromosome and start and end coordinates. Optionally, the strand (+ or -) can also be present; if so, the PyRanges object is “Stranded”. The ranges can additionally have an arbitrary number of meta-data fields, i.e. columns associated with them.

Note that PyRanges follows the standard python convention:

  • coordinates are 0-based

  • in each interval, the start is included and the end is excluded.

Some genomic coordinate formats (GFF, GTF) use a 1-based, start-and-end-included format. Pyranges takes care of converting between these conventions when loading and writing files in these formats.

PyRanges objects are a subclass of Pandas DataFrame, extending its functionalities to genomic operations. This means that the vast pandas/numpy ecosystem for high-performance scientific computing is available to manipulate the data directly in PyRanges objects. While not strictly necessary, having familiarity with pandas greatly facilitates the use of PyRanges.

Getting started

We recommend using ipython or Jupyter for this tutorial. Besides pyranges1 and pandas, we will use optional modules (e.g. pyfaidx). If you haven’t already, install the optional add-ons with:

pip install pyranges1[add-ons]

Loading and accessing pyranges1 objects

Let’s import libraries, and load in memory an example annotation in GFF3 format, consisting of a portion of the genome annotation of the worm Dimorphilus gyrociliatus.

>>> import pyranges1 as pr
>>> ann = pr.example_data.ncbi_gff
>>> ann
index    |    Chromosome         Source    Feature     Start    End      Score    Strand      Frame    ...
int64    |    category           str       category    int64    int64    str      category    str      ...
-------  ---  -----------------  --------  ----------  -------  -------  -------  ----------  -------  -----
0        |    CAJFCJ010000053.1  EMBL      region      0        109277   .        +           .        ...
1        |    CAJFCJ010000053.1  EMBL      gene        4882     5264     .        -           .        ...
2        |    CAJFCJ010000053.1  EMBL      mRNA        4882     5264     .        -           .        ...
3        |    CAJFCJ010000053.1  EMBL      exon        4882     5264     .        -           .        ...
...      |    ...                ...       ...         ...      ...      ...      ...         ...      ...
146      |    CAJFCJ010000025.1  EMBL      CDS         2753     2851     .        -           0        ...
147      |    CAJFCJ010000025.1  EMBL      CDS         2593     2693     .        -           1        ...
148      |    CAJFCJ010000025.1  EMBL      CDS         2354     2537     .        -           0        ...
149      |    CAJFCJ010000025.1  EMBL      CDS         2174     2294     .        -           0        ...
PyRanges with 150 rows, 21 columns, and 1 index columns. (13 columns not shown: "ID", "Dbxref", "gbkey", ...).
Contains 6 chromosomes and 2 strands.

Above, we leveraged the builtin example data. In real use cases, you would load data from a file, using methods like read_gtf, read_bed and others (see all readers in The pyranges1 module).

The ann object has lots of columns, most of which are not displayed because of space. Here’s the full list:

>>> ann.columns
Index(['Chromosome', 'Source', 'Feature', 'Start', 'End', 'Score', 'Strand',
       'Frame', 'ID', 'Dbxref', 'gbkey', 'mol_type', 'note', 'Name',
       'gene_biotype', 'locus_tag', 'Parent', 'Note', 'standard_name',
       'product', 'protein_id'],
      dtype='str')

Let’s select only certain columns. We can use the method get_with_loc_columns to select columns by name, and retain the “genomic location” columns Chromosome, Start, End, (and Strand if present):

>>> ann = ann.get_with_loc_columns(['Feature', 'Parent', 'ID'])
>>> ann
index    |    Chromosome         Start    End      Strand      Feature     Parent                 ...
int64    |    category           int64    int64    category    category    str                    ...
-------  ---  -----------------  -------  -------  ----------  ----------  ---------------------  -----
0        |    CAJFCJ010000053.1  0        109277   +           region      nan                    ...
1        |    CAJFCJ010000053.1  4882     5264     -           gene        nan                    ...
2        |    CAJFCJ010000053.1  4882     5264     -           mRNA        gene-DGYR_LOCUS13733   ...
3        |    CAJFCJ010000053.1  4882     5264     -           exon        rna-DGYR_LOCUS13733    ...
...      |    ...                ...      ...      ...         ...         ...                    ...
146      |    CAJFCJ010000025.1  2753     2851     -           CDS         rna-DGYR_LOCUS12552-2  ...
147      |    CAJFCJ010000025.1  2593     2693     -           CDS         rna-DGYR_LOCUS12552-2  ...
148      |    CAJFCJ010000025.1  2354     2537     -           CDS         rna-DGYR_LOCUS12552-2  ...
149      |    CAJFCJ010000025.1  2174     2294     -           CDS         rna-DGYR_LOCUS12552-2  ...
PyRanges with 150 rows, 7 columns, and 1 index columns. (1 columns not shown: "ID").
Contains 6 chromosomes and 2 strands.

The Chromosome column can take any value among the sequence names in the genome assembly. In top-quality assemblies, it corresponds to actual chromosomes, and in other cases it is contigs or scaffolds; for simplicity, here we refer to it as chromosomes. In a fasta file, the sequence name is the first word of a header line (i.e. those starting with “>”). Let’s peek the assembly fasta file available as example data:

>>> genome_file = pr.example_data.files['ncbi.fasta']
>>> with open(genome_file) as fh:
...   for _ in range(8):
...     print(fh.readline().strip())
>CAJFCJ010000053.1 Dimorphilus gyrociliatus genome assembly, contig: scaffold053, whole genome shotgun sequence
aaaaaaagaagtttttgacaaactttttctttttttcatcaagCTTTGTATAATGGACAA
ACTAACgcaactttttcaattactGTTAACAAACTACCTGAAACAATTTACAATTCAAAA
AGTACATTTTGTATTAGAAATTATTCCAAGAAAATTCAAGTAGATTTGAAATTCATGATT
TAACTTGTGAAATTGTGTataaggaaaatatataaatattttcaaaactgTTACTTTGGA
TACTAAAGAAATTCCattagaaataattgaaatatttgtatatacttcaccaaatgaaag
aatgaatgaaataagtaaaaataaaatggagaaatttttttttttaattttttttctctt
tcttcctttattCATAGctttatttgataatttcaaGAGTATAATTGAAGAGATCAGTGT

Genomic annotations often contain information for diverse entities, such as genes, mRNAs, exons, CDS, etc. In GFF files, the entity type is encoded in the Feature column. In pyranges1, you use the dot notation to fetch an individual column, which is technically a pandas Series:

>>> ann.Feature # or ann['Feature']  
0      region
1        gene
2        mRNA
3        exon
4         CDS
        ...
145       CDS
146       CDS
147       CDS
148       CDS
149       CDS
Name: Feature, Length: 150, dtype: category
Categories (5, str): ['CDS', 'exon', 'gene', 'mRNA', 'region']

The syntax ann[column_name] is also available, and must be used when creating or updating a column. Let’s create a new column with the midpoint of each interval:

>>> ann['midpoint'] = (ann.Start + ann.End) // 2
>>> ann.get_with_loc_columns(['midpoint'])
index    |    Chromosome         Start    End      Strand      midpoint
int64    |    category           int64    int64    category    int64
-------  ---  -----------------  -------  -------  ----------  ----------
0        |    CAJFCJ010000053.1  0        109277   +           54638
1        |    CAJFCJ010000053.1  4882     5264     -           5073
2        |    CAJFCJ010000053.1  4882     5264     -           5073
3        |    CAJFCJ010000053.1  4882     5264     -           5073
...      |    ...                ...      ...      ...         ...
146      |    CAJFCJ010000025.1  2753     2851     -           2802
147      |    CAJFCJ010000025.1  2593     2693     -           2643
148      |    CAJFCJ010000025.1  2354     2537     -           2445
149      |    CAJFCJ010000025.1  2174     2294     -           2234
PyRanges with 150 rows, 5 columns, and 1 index columns.
Contains 6 chromosomes and 2 strands.

Let’s focus on a row subset of the annotation: CDS intervals, corresponding to coding sequences. We filter rows and create a new PyRanges object called cds:

>>> selector = (ann.Feature == 'CDS')
>>> cds = ann [selector]

The object selector is a Series of boolean values, so it can be used to index PyRanges.

Now, let’s further reduce the width of the cds object. We showcase an alternative method for column selection: drop lets us choose which columns to discard.

>>> cds = cds.drop( ['Feature', 'Parent', 'midpoint'], axis=1 )
>>> cds
index    |    Chromosome         Start    End      Strand      ID
int64    |    category           int64    int64    category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
4        |    CAJFCJ010000053.1  4882     5263     -           cds-CAD5126491.1
11       |    CAJFCJ010000053.1  10732    10958    +           cds-CAD5126492.1
12       |    CAJFCJ010000053.1  11028    11169    +           cds-CAD5126492.1
13       |    CAJFCJ010000053.1  11227    11400    +           cds-CAD5126492.1
...      |    ...                ...      ...      ...         ...
146      |    CAJFCJ010000025.1  2753     2851     -           cds-CAD5125114.1
147      |    CAJFCJ010000025.1  2593     2693     -           cds-CAD5125114.1
148      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125114.1
149      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125114.1
PyRanges with 56 rows, 5 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

drop is actually a method of pandas dataframe, inherited by PyRanges. Whenever a pandas methods is applied to a PyRanges object, if the returned object has the genomic location columns, then it is returned as a PyRanges object. Otherwise, a dataframe is returned.

We already seen a boolean selector to filter rows. The loc and iloc pandas operators are also available. Besides, pyranges1 offers the loci operator for selecting intervals in a genomic region of interest. It accepts various syntaxes. The code below will show intervals overlapping with the specified position range in the requested chromosome:

>>> reg = cds.loci['CAJFCJ010000097.1', '+', 50000:55000]
>>> reg
index    |    Chromosome         Start    End      Strand      ID
int64    |    category           int64    int64    category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
110      |    CAJFCJ010000097.1  51865    52382    +           cds-CAD5126878.1
111      |    CAJFCJ010000097.1  52446    52826    +           cds-CAD5126878.1
112      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126878.1
113      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126878.1
...      |    ...                ...      ...      ...         ...
121      |    CAJFCJ010000097.1  52261    52382    +           cds-CAD5126877.1
122      |    CAJFCJ010000097.1  52446    52826    +           cds-CAD5126877.1
123      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126877.1
124      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126877.1
PyRanges with 9 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

We cannot see all rows because of space. We can set how many rows are displayed using pyranges1.options.set_option():

>>> pr.options.set_option('max_rows_to_show', 10)
>>> reg
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
    110  |    CAJFCJ010000097.1    51865    52382  +           cds-CAD5126878.1
    111  |    CAJFCJ010000097.1    52446    52826  +           cds-CAD5126878.1
    112  |    CAJFCJ010000097.1    52903    53027  +           cds-CAD5126878.1
    113  |    CAJFCJ010000097.1    53339    53404  +           cds-CAD5126878.1
    120  |    CAJFCJ010000097.1    51865    52201  +           cds-CAD5126877.1
    121  |    CAJFCJ010000097.1    52261    52382  +           cds-CAD5126877.1
    122  |    CAJFCJ010000097.1    52446    52826  +           cds-CAD5126877.1
    123  |    CAJFCJ010000097.1    52903    53027  +           cds-CAD5126877.1
    124  |    CAJFCJ010000097.1    53339    53404  +           cds-CAD5126877.1
PyRanges with 9 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

Let’s go back to default display settings:

>>> pr.options.reset_options()

Working with groups of exons

Multi-exonic genes are represented with multiple rows in PyRanges. In this tutorial, the ID column links the intervals belonging to the same CDS: these rows have the same ID value. While this concept applies to all annotations, files from different sources may use different column names for this purpose (e.g. transcript_id). Note that here we focus on CDS regions. These may encompass multiple exons, but they do not span the whole mRNA: the 5’UTRs and 3’UTRs are not included. Various PyRanges methods are available to work with groups of intervals, accepting argument group_by.

Next, we will examine the first and last codon of annotated CDSs. We will obtain their genomic coordinate, then fetch their sequence.

Method slice_ranges allows to obtain a subregion of groups of intervals. The code below derives the first codon of each CDS group; grouping is defined by their ID:

>>> first=cds.slice_ranges(start=0, end=3, group_by='ID')
>>> first
index    |    Chromosome         Start    End      Strand      ID
int64    |    category           int64    int64    category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
4        |    CAJFCJ010000053.1  5260     5263     -           cds-CAD5126491.1
11       |    CAJFCJ010000053.1  10732    10735    +           cds-CAD5126492.1
18       |    CAJFCJ010000053.1  19649    19652    +           cds-CAD5126493.1
25       |    CAJFCJ010000053.1  27136    27139    -           cds-CAD5126494.1
...      |    ...                ...      ...      ...         ...
120      |    CAJFCJ010000097.1  51865    51868    +           cds-CAD5126877.1
135      |    CAJFCJ010000025.1  2753     2755     -           cds-CAD5125115.1
136      |    CAJFCJ010000025.1  2692     2693     -           cds-CAD5125115.1
145      |    CAJFCJ010000025.1  3150     3153     -           cds-CAD5125114.1
PyRanges with 18 rows, 5 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

Let’s fetch the sequence for each of these intervals from our genome fasta file.

The function get_sequence returns one sequence per interval, which we assign to a new column of our pyranges1 object:

>>> first['Sequence'] = first.get_sequence(genome_file)  #genome_file defined above
>>> first
index    |    Chromosome         Start    End      Strand      ID                Sequence
int64    |    category           int64    int64    category    str               object
-------  ---  -----------------  -------  -------  ----------  ----------------  ----------
4        |    CAJFCJ010000053.1  5260     5263     -           cds-CAD5126491.1  ATG
11       |    CAJFCJ010000053.1  10732    10735    +           cds-CAD5126492.1  ATG
18       |    CAJFCJ010000053.1  19649    19652    +           cds-CAD5126493.1  ATG
25       |    CAJFCJ010000053.1  27136    27139    -           cds-CAD5126494.1  ATG
...      |    ...                ...      ...      ...         ...               ...
120      |    CAJFCJ010000097.1  51865    51868    +           cds-CAD5126877.1  ATG
135      |    CAJFCJ010000025.1  2753     2755     -           cds-CAD5125115.1  at
136      |    CAJFCJ010000025.1  2692     2693     -           cds-CAD5125115.1  g
145      |    CAJFCJ010000025.1  3150     3153     -           cds-CAD5125114.1  ATG
PyRanges with 18 rows, 6 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

The Sequence column is a pandas Series containing strings. We see that the starting codon is ATG in most cases, as expected. When we check the length of the sequences, we notice that some are not 3-letter long:

>>> bool( (first.Sequence.str.len() == 3 ).all() )
False

Let’s look at those sequences, using a row selector as before:

>>> first [ first.Sequence.str.len() != 3 ]
  index  |    Chromosome           Start      End  Strand      ID                Sequence
  int64  |    category             int64    int64  category    str               object
-------  ---  -----------------  -------  -------  ----------  ----------------  ----------
    135  |    CAJFCJ010000025.1     2753     2755  -           cds-CAD5125115.1  at
    136  |    CAJFCJ010000025.1     2692     2693  -           cds-CAD5125115.1  g
PyRanges with 2 rows, 6 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

In some cases the starting codon is split between two exons. This is uncommon, but expected at least in a few genes in a genome. How do we get the full codon sequence?

Function get_sequence can accept a group_by argument, thus returning the concatenated sequence of a group of intervals, i.e. joining exons together. The sequence is given 5’ to 3’.

>>> seq_first = first.get_sequence(genome_file, group_by='ID')
>>> seq_first 
ID
cds-CAD5125114.1    ATG
cds-CAD5125115.1    atg
cds-CAD5126491.1    ATG
cds-CAD5126492.1    ATG
cds-CAD5126493.1    ATG
cds-CAD5126494.1    ATG
cds-CAD5126495.1    ATG
cds-CAD5126496.1    atg
cds-CAD5126497.1    ATG
cds-CAD5126498.1    atg
cds-CAD5126499.1    atg
cds-CAD5126873.1    ATG
cds-CAD5126874.1    ATG
cds-CAD5126875.1    ATG
cds-CAD5126876.1    ATG
cds-CAD5126877.1    ATG
cds-CAD5126878.1    ATG
Name: Sequence, dtype: object

Note that, when get_sequence is called with the group_by argument, the output is indexed by the group_by column, in this case the ID. Here we confirm the sequence length is always 3:

>>> bool( (seq_first.str.len()==3).all() )
True

Ok, so far we got the coordinates and sequences of the first codon of each CDS.

Now let’s look at stop codons. First, we get the a pyranges1 object of the last codon of each CDS. Conveniently, slice_ranges accepts negative arguments to count from the 3’, so we can obtain the last three nucleotides of CDSs with:

>>> last = cds.slice_ranges(start=-3, group_by='ID')

By not providing an end argument, we requested intervals that reach the very end of each CDS group. Let’s get their sequence as before:

>>> seq_last = last.get_sequence(genome_file, group_by='ID').str.upper()
>>> seq_last 
ID
cds-CAD5125114.1    TGA
cds-CAD5125115.1    TGA
cds-CAD5126491.1    TAA
cds-CAD5126492.1    TGA
cds-CAD5126493.1    TAA
cds-CAD5126494.1    TAG
cds-CAD5126495.1    TAA
cds-CAD5126496.1    TGA
cds-CAD5126497.1    TAA
cds-CAD5126498.1    TAA
cds-CAD5126499.1    TAG
cds-CAD5126873.1    TGA
cds-CAD5126874.1    TAG
cds-CAD5126875.1    TAA
cds-CAD5126876.1    TGA
cds-CAD5126877.1    TAA
cds-CAD5126878.1    TAA
Name: Sequence, dtype: object

Let’s use pandas value_counts to see the usage of stop codons:

>>> seq_last.value_counts()
Sequence
TAA    8
TGA    6
TAG    3
Name: count, dtype: int64

Say we want to focus on CDSs with a TAA stop codon. Let’s gather the IDs of those CDSs:

>>> taa_stop_ids = seq_last[ seq_last == 'TAA' ].index

We can now use this list to subset the cds object:

>>> taa_stop_cds = cds[ cds.ID.isin(taa_stop_ids) ]

Writing coordinates and sequences to the disk

We obtained a custom genome annotation, consisting of CDS with a TAA stop codon. We can now write this PyRanges object to a file, for example in GTF format using method to_gtf:

>>> taa_stop_cds.to_gtf('Dgyro.taa_CDS.gtf')

Let’s get the sequence for these CDSs and write it to a tabular file using pandas method to_csv:

>>> taa_stop_cds_seqs = taa_stop_cds.get_sequence(genome_file, group_by='ID')
>>> taa_stop_cds_seqs.to_csv('Dgyro_taa_CDS_seqs.tsv', sep='\t', index=True)

Note that taa_stop_cds_seqs is a pandas Series. To write sequences in fasta format we may use:

>>> with open('Dgyro_taa_CDS_seqs.fa', 'w') as fw: 
...   for xid, xseq in taa_stop_cds_seqs.itertuples():
...     fw.write(f'>{xid}\n{xseq}\n')

Extending genomic intervals

Now we want to obtain (a toy approximation of) promoter sequences, here defined as the 300bp region before the start codon. Before we begin, let’s peek into our object cds using the pandas method head:

>>> cds.head()
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
      4  |    CAJFCJ010000053.1     4882     5263  -           cds-CAD5126491.1
     11  |    CAJFCJ010000053.1    10732    10958  +           cds-CAD5126492.1
     12  |    CAJFCJ010000053.1    11028    11169  +           cds-CAD5126492.1
     13  |    CAJFCJ010000053.1    11227    11400  +           cds-CAD5126492.1
     14  |    CAJFCJ010000053.1    11453    14183  +           cds-CAD5126492.1
PyRanges with 5 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

First, we use the method extend_ranges to obtain intervals which include the CDS and the promoter defined as above. We will group by the ID column, so that the extension is applied to each CDS group (i.e. in this case only the 5’ most interval of each group).

>>> g = cds.extend_ranges(ext_5=300, group_by='ID')
>>> g.head()
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
      4  |    CAJFCJ010000053.1     4882     5563  -           cds-CAD5126491.1
     11  |    CAJFCJ010000053.1    10432    10958  +           cds-CAD5126492.1
     12  |    CAJFCJ010000053.1    11028    11169  +           cds-CAD5126492.1
     13  |    CAJFCJ010000053.1    11227    11400  +           cds-CAD5126492.1
     14  |    CAJFCJ010000053.1    11453    14183  +           cds-CAD5126492.1
PyRanges with 5 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

In the object we obtained, the promoter corresponds to the first 300 bp of every interval group. We can use method slice_ranges again to get it:

>>> prom = g.slice_ranges(0, 300, group_by='ID')
>>> prom.head()
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
      4  |    CAJFCJ010000053.1     5263     5563  -           cds-CAD5126491.1
     11  |    CAJFCJ010000053.1    10432    10732  +           cds-CAD5126492.1
     18  |    CAJFCJ010000053.1    19349    19649  +           cds-CAD5126493.1
     25  |    CAJFCJ010000053.1    27139    27439  -           cds-CAD5126494.1
     32  |    CAJFCJ010000053.1    38860    39160  +           cds-CAD5126495.1
PyRanges with 5 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

So far we applied extend_ranges and slice_ranges to obtain the regions immediately upstream of each CDS group. In latest versions, pyranges1 offers a direct method to perform this operation, called upstream (as well as its 3’ analog downstream):

>>> cds.upstream(length=300, group_by='ID').head()
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
      4  |    CAJFCJ010000053.1     5263     5563  -           cds-CAD5126491.1
     11  |    CAJFCJ010000053.1    10432    10732  +           cds-CAD5126492.1
     18  |    CAJFCJ010000053.1    19349    19649  +           cds-CAD5126493.1
     25  |    CAJFCJ010000053.1    27139    27439  -           cds-CAD5126494.1
     32  |    CAJFCJ010000053.1    38860    39160  +           cds-CAD5126495.1
PyRanges with 5 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

Because we extended intervals, some may have gone out-of-bounds on the left or on the right side: they may have a Start smaller than 0, or an End greater than the length of its chromosome, respectively. The function clip_ranges is designed to correct this:

>>> import pyfaidx
>>> pyf=pyfaidx.Fasta(genome_file)
>>> cor_prom = prom.clip_ranges(chromsizes=pyf)
>>> cor_prom.head()
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
      4  |    CAJFCJ010000053.1     5263     5563  -           cds-CAD5126491.1
     11  |    CAJFCJ010000053.1    10432    10732  +           cds-CAD5126492.1
     18  |    CAJFCJ010000053.1    19349    19649  +           cds-CAD5126493.1
     25  |    CAJFCJ010000053.1    27139    27439  -           cds-CAD5126494.1
     32  |    CAJFCJ010000053.1    38860    39160  +           cds-CAD5126495.1
PyRanges with 5 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

To detect cases of out-of-bounds on the right side, clip_ranges needs to know chromosome sizes. Various input types are accepted for the chromsizes argument; above, we used a pyfaidx.Fasta object, which derives it from a fasta file.

You see below that some intervals were gone out-of-bounds on the right side, and have been corrected:

>>> select_diff_end = cor_prom.End != prom.End
>>> prom[select_diff_end]
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
    145  |    CAJFCJ010000025.1     3153     3453  -           cds-CAD5125114.1
PyRanges with 1 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.
>>> cor_prom[select_diff_end]
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
    145  |    CAJFCJ010000025.1     3153     3418  -           cds-CAD5125114.1
PyRanges with 1 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

Detecting overlaps among intervals

Pyranges offers many efficient methods to detect overlaps, such as overlap. This method returns the rows in self that overlap with another PyRanges object.

Let’s see if any of the promoter regions overlap other CDSs:

>>> cor_prom.overlap(cds)
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
    135  |    CAJFCJ010000025.1     2755     3055  -           cds-CAD5125115.1
PyRanges with 1 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

As many PyRanges methods, the Strand (if present) is taken into account in the comparison, so that the overlap between intervals is reported only if they are on the same strand. Argument strand_behavior is available in many functions to control how strand is handled in overlap comparisons (see overlap).

Above, we obtained the promoter region that overlaps another CDS, but we don’t know what CDS it is. Function join_overlaps will find overlaps and combine the columns of the overlapping intervals, similar to a SQL join operation:

>>> j = cor_prom.join_overlaps(cds)
>>> j
  index  |    Chromosome           Start      End  Strand      ID                  Start_b    End_b  ID_b
  int64  |    category             int64    int64  category    str                   int64    int64  str
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------  -------  ----------------
    135  |    CAJFCJ010000025.1     2755     3055  -           cds-CAD5125115.1       2753     2851  cds-CAD5125114.1
PyRanges with 1 rows, 8 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

The object j contains the columns of both objects, with the suffix “_b” to distinguish the second one (cds). It may be a bit too wide for our taste. Let’s just look at a few columns to understand the overlap:

>>> j[['ID', 'Start', 'End', 'ID_b', 'Start_b', 'End_b']]
                   ID  Start   End              ID_b  Start_b  End_b
135  cds-CAD5125115.1   2755  3055  cds-CAD5125114.1     2753   2851

Above, we used a pandas syntax to select columns. Because the returned object does not have all genomic location columns, it is a pandas DataFrame.

Let’s get the intersection between the overlapping intervals, using function intersect_overlaps:

>>> prom_in_cds = cor_prom.intersect_overlaps(cds)
>>> prom_in_cds
  index  |    Chromosome           Start      End  Strand      ID
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
    135  |    CAJFCJ010000025.1     2755     2851  -           cds-CAD5125115.1
PyRanges with 1 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

Let’s go back to the cds object and see if any of its intervals overlap each other. We can use cluster_overlaps. This will assign each interval to a cluster, identified by an integer. The intervals that overlap each other will be assigned to the same cluster.

>>> clu_cds = cds.cluster_overlaps()
>>> clu_cds
index    |    Chromosome         Start    End      Strand      ID                Cluster
int64    |    category           int64    int64    category    str               uint32
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------
138      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125115.1  0
149      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125114.1  0
137      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125115.1  1
148      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125114.1  1
...      |    ...                ...      ...      ...         ...               ...
95       |    CAJFCJ010000097.1  5579     6029     -           cds-CAD5126874.1  47
94       |    CAJFCJ010000097.1  6082     6450     -           cds-CAD5126874.1  48
93       |    CAJFCJ010000097.1  6505     6599     -           cds-CAD5126874.1  49
103      |    CAJFCJ010000097.1  31876    32194    -           cds-CAD5126876.1  50
PyRanges with 56 rows, 6 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

Let’s get the clusters that have more than one interval in them, using pandas identified by an integer. The intervals that overlap each other will be assigned to the same cluster.

>>> clu_cds = cds.cluster_overlaps()
>>> clu_cds
index    |    Chromosome         Start    End      Strand      ID                Cluster
int64    |    category           int64    int64    category    str               uint32
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------
138      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125115.1  0
149      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125114.1  0
137      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125115.1  1
148      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125114.1  1
...      |    ...                ...      ...      ...         ...               ...
95       |    CAJFCJ010000097.1  5579     6029     -           cds-CAD5126874.1  47
94       |    CAJFCJ010000097.1  6082     6450     -           cds-CAD5126874.1  48
93       |    CAJFCJ010000097.1  6505     6599     -           cds-CAD5126874.1  49
103      |    CAJFCJ010000097.1  31876    32194    -           cds-CAD5126876.1  50
PyRanges with 56 rows, 6 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

Let’s get the clusters that have more than one interval in them, using pandas identified by an integer. The intervals that overlap each other will be assigned to the same cluster.

>>> clu_cds = cds.cluster_overlaps()
>>> clu_cds
index    |    Chromosome         Start    End      Strand      ID                Cluster
int64    |    category           int64    int64    category    str               uint32
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------
138      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125115.1  0
149      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125114.1  0
137      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125115.1  1
148      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125114.1  1
...      |    ...                ...      ...      ...         ...               ...
95       |    CAJFCJ010000097.1  5579     6029     -           cds-CAD5126874.1  47
94       |    CAJFCJ010000097.1  6082     6450     -           cds-CAD5126874.1  48
93       |    CAJFCJ010000097.1  6505     6599     -           cds-CAD5126874.1  49
103      |    CAJFCJ010000097.1  31876    32194    -           cds-CAD5126876.1  50
PyRanges with 56 rows, 6 columns, and 1 index columns.
Contains 3 chromosomes and 2 strands.

Let’s get the clusters that have more than one interval in them, using pandas value_counts:

>>> c = clu_cds.Cluster.value_counts()
>>> multi_clusters = c[ c > 1 ].index
>>> multi_clu_cds = clu_cds[ clu_cds.Cluster.isin(multi_clusters) ].copy()
>>> multi_clu_cds
index    |    Chromosome         Start    End      Strand      ID                Cluster
int64    |    category           int64    int64    category    str               uint32
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------
138      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125115.1  0
149      |    CAJFCJ010000025.1  2174     2294     -           cds-CAD5125114.1  0
137      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125115.1  1
148      |    CAJFCJ010000025.1  2354     2537     -           cds-CAD5125114.1  1
...      |    ...                ...      ...      ...         ...               ...
112      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126878.1  44
123      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126877.1  44
113      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126878.1  45
124      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126877.1  45
PyRanges with 17 rows, 6 columns, and 1 index columns.
Contains 2 chromosomes and 2 strands.

Sorting intervals

Above, it is not apparent that there are overlaps among the intervals in the object multi_clu_cds. This is due to the order of rows. We could sort rows using pandas sort_values, but Pyranges offers something better: the method sort_ranges sorts by chromosome, strand, then by coordinates. By default, intervals are sorted 5’ to 3’, meaning that intervals on the positive strand are sorted from left-most to right-most, while intervals on the negative strand are sorted in the opposite direction.

>>> multi_clu_cds.sort_ranges()
index    |    Chromosome         Start    End      Strand      ID                Cluster
int64    |    category           int64    int64    category    str               uint32
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------
146      |    CAJFCJ010000025.1  2753     2851     -           cds-CAD5125114.1  3
135      |    CAJFCJ010000025.1  2753     2755     -           cds-CAD5125115.1  3
136      |    CAJFCJ010000025.1  2593     2693     -           cds-CAD5125115.1  2
147      |    CAJFCJ010000025.1  2593     2693     -           cds-CAD5125114.1  2
...      |    ...                ...      ...      ...         ...               ...
112      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126878.1  44
123      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126877.1  44
113      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126878.1  45
124      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126877.1  45
PyRanges with 17 rows, 6 columns, and 1 index columns.
Contains 2 chromosomes and 2 strands.

sort_ranges can be combined by Pandas sort_values to customize the sorting. For example, let’s add a columns with the lengths of each interval. Thus, sort by chromosome, strand, length, then interval coordinates:

>>> multi_clu_cds['Length'] = multi_clu_cds.lengths()
>>> multi_clu_cds.sort_ranges().sort_values(["Chromosome", "Strand", "Length"], kind="stable")
index    |    Chromosome         Start    End      Strand      ID                Cluster    Length
int64    |    category           int64    int64    category    str               uint32     int64
-------  ---  -----------------  -------  -------  ----------  ----------------  ---------  --------
135      |    CAJFCJ010000025.1  2753     2755     -           cds-CAD5125115.1  3          2
146      |    CAJFCJ010000025.1  2753     2851     -           cds-CAD5125114.1  3          98
136      |    CAJFCJ010000025.1  2593     2693     -           cds-CAD5125115.1  2          100
147      |    CAJFCJ010000025.1  2593     2693     -           cds-CAD5125114.1  2          100
...      |    ...                ...      ...      ...         ...               ...        ...
120      |    CAJFCJ010000097.1  51865    52201    +           cds-CAD5126877.1  42         336
111      |    CAJFCJ010000097.1  52446    52826    +           cds-CAD5126878.1  43         380
122      |    CAJFCJ010000097.1  52446    52826    +           cds-CAD5126877.1  43         380
110      |    CAJFCJ010000097.1  51865    52382    +           cds-CAD5126878.1  42         517
PyRanges with 17 rows, 7 columns, and 1 index columns.
Contains 2 chromosomes and 2 strands.

Other overlap-based operations

Say that we are interested in intergenic regions in chromosome CAJFCJ010000097.1. In any genome annotation, the annotation rows “exon” define transcript coordinates. Let’s fetch them from the annotation ann:

>>> exons = ann[ ann.Feature == 'exon' ].loci['CAJFCJ010000097.1']
>>> exons
index    |    Chromosome         Start    End      Strand      Feature     Parent                 ...
int64    |    category           int64    int64    category    category    str                 ...
-------  ---  -----------------  -------  -------  ----------  ----------  ---------------------  -----
86       |    CAJFCJ010000097.1  2248     3308     +           exon        rna-DGYR_LOCUS14091    ...
90       |    CAJFCJ010000097.1  6505     6600     -           exon        rna-DGYR_LOCUS14092    ...
91       |    CAJFCJ010000097.1  6082     6450     -           exon        rna-DGYR_LOCUS14092    ...
92       |    CAJFCJ010000097.1  5579     6029     -           exon        rna-DGYR_LOCUS14092    ...
...      |    ...                ...      ...      ...         ...         ...                    ...
116      |    CAJFCJ010000097.1  52261    52382    +           exon        rna-DGYR_LOCUS14095-2  ...
117      |    CAJFCJ010000097.1  52446    52826    +           exon        rna-DGYR_LOCUS14095-2  ...
118      |    CAJFCJ010000097.1  52903    53027    +           exon        rna-DGYR_LOCUS14095-2  ...
119      |    CAJFCJ010000097.1  53339    53404    +           exon        rna-DGYR_LOCUS14095-2  ...
PyRanges with 15 rows, 8 columns, and 1 index columns. (2 columns not shown: "ID", "midpoint").
Contains 1 chromosomes and 2 strands.

Let’s define the boundaries of each mRNA, e.g. the left and right limits of its exons. While this may be readily available in the genome annotation, let’s use PyRanges to calculate them, using outer_ranges:

>>> mRNA_bounds = exons.outer_ranges(group_by='Parent')
>>> mRNA_bounds
  index  |    Chromosome           Start      End  Strand      Parent
  int64  |    category             int64    int64  category    str
-------  ---  -----------------  -------  -------  ----------  ---------------------
      0  |    CAJFCJ010000097.1     2248     3308  +           rna-DGYR_LOCUS14091
      1  |    CAJFCJ010000097.1    16697    17634  +           rna-DGYR_LOCUS14093
      2  |    CAJFCJ010000097.1    51864    53404  +           rna-DGYR_LOCUS14095
      3  |    CAJFCJ010000097.1    51864    53404  +           rna-DGYR_LOCUS14095-2
      4  |    CAJFCJ010000097.1     5579     6600  -           rna-DGYR_LOCUS14092
      5  |    CAJFCJ010000097.1    31876    32195  -           rna-DGYR_LOCUS14094
PyRanges with 6 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 2 strands.

To get the intergenic regions, let’s define the maximum and minimum coordinates of any mRNA in this region, using outer_ranges again without group_by. Because we want our result to not depend on strand, we remove it using remove_strand:

>>> all_mRNA_bounds = mRNA_bounds.remove_strand().outer_ranges()
>>> all_mRNA_bounds
  index  |    Chromosome           Start      End
  int64  |    category             int64    int64
-------  ---  -----------------  -------  -------
      0  |    CAJFCJ010000097.1     2248    53404
PyRanges with 1 rows, 3 columns, and 1 index columns.
Contains 1 chromosomes.

Now we can get the intergenic regions using subtract_overlaps:

>>> intergenic = all_mRNA_bounds.subtract_overlaps(mRNA_bounds)
>>> intergenic
  index  |    Chromosome           Start      End
  int64  |    category             int64    int64
-------  ---  -----------------  -------  -------
      0  |    CAJFCJ010000097.1     3308     5579
      0  |    CAJFCJ010000097.1     6600    16697
      0  |    CAJFCJ010000097.1    17634    31876
      0  |    CAJFCJ010000097.1    32195    51864
PyRanges with 4 rows, 3 columns, and 1 index columns (with 3 index duplicates).
Contains 1 chromosomes.

Note that pyranges1 indicates that the object has duplicate indices, because all come from the same row in all_mRNA_bounds, broken into subintervals by the subtraction operation. We can use pandas reset_index to remedy:

>>> intergenic = intergenic.reset_index(drop=True)
>>> intergenic
  index  |    Chromosome           Start      End
  int64  |    category             int64    int64
-------  ---  -----------------  -------  -------
      0  |    CAJFCJ010000097.1     3308     5579
      1  |    CAJFCJ010000097.1     6600    16697
      2  |    CAJFCJ010000097.1    17634    31876
      3  |    CAJFCJ010000097.1    32195    51864
PyRanges with 4 rows, 3 columns, and 1 index columns.
Contains 1 chromosomes.

Counting overlaps

Often, one wants to count the number of overlaps between two PyRanges objects, e.g. to count reads in specific regions. Here, let’s count the number of CDS intervals that overlap our previously computed objects intergenic and all_mRNA_bounds, using method count_overlaps :

>>> intergenic.count_overlaps(cds)
  index  |    Chromosome           Start      End     Count
  int64  |    category             int64    int64    uint32
-------  ---  -----------------  -------  -------  --------
      0  |    CAJFCJ010000097.1     3308     5579         0
      1  |    CAJFCJ010000097.1     6600    16697         0
      2  |    CAJFCJ010000097.1    17634    31876         0
      3  |    CAJFCJ010000097.1    32195    51864         0
PyRanges with 4 rows, 4 columns, and 1 index columns.
Contains 1 chromosomes.
>>> all_mRNA_bounds.count_overlaps(cds)
  index  |    Chromosome           Start      End     Count
  int64  |    category             int64    int64    uint32
-------  ---  -----------------  -------  -------  --------
      0  |    CAJFCJ010000097.1     2248    53404        15
PyRanges with 1 rows, 4 columns, and 1 index columns.
Contains 1 chromosomes.

As expected, there’s no CDS overlapping the intergenic regions, while the other object reports 15. Yet, the CDS intervals may be redundant: different splicing isoforms may have some identical exons:

>>> example = cds.loci['CAJFCJ010000097.1', '+', 51000:54000].sort_ranges()
>>> example
index    |    Chromosome         Start    End      Strand      ID
int64    |    category           int64    int64    category    str
-------  ---  -----------------  -------  -------  ----------  ----------------
120      |    CAJFCJ010000097.1  51865    52201    +           cds-CAD5126877.1
110      |    CAJFCJ010000097.1  51865    52382    +           cds-CAD5126878.1
121      |    CAJFCJ010000097.1  52261    52382    +           cds-CAD5126877.1
111      |    CAJFCJ010000097.1  52446    52826    +           cds-CAD5126878.1
...      |    ...                ...      ...      ...         ...
112      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126878.1
123      |    CAJFCJ010000097.1  52903    53027    +           cds-CAD5126877.1
113      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126878.1
124      |    CAJFCJ010000097.1  53339    53404    +           cds-CAD5126877.1
PyRanges with 9 rows, 5 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

If we want to calculate the intervals that are annotated as CDS in any of the isoforms, we can use method merge_overlaps :

>>> example.merge_overlaps()
  index  |    Chromosome           Start      End  Strand
  int64  |    category             int64    int64  category
-------  ---  -----------------  -------  -------  ----------
      0  |    CAJFCJ010000097.1    51865    52382  +
      1  |    CAJFCJ010000097.1    52446    52826  +
      2  |    CAJFCJ010000097.1    52903    53027  +
      3  |    CAJFCJ010000097.1    53339    53404  +
PyRanges with 4 rows, 4 columns, and 1 index columns.
Contains 1 chromosomes and 1 strands.

Various methods are available to obtain non-overlapping intervals, depending on the desired output. See split_overlaps, max_disjoint_overlaps.

Finally, let’s count how many non-redundant CDS intervals overlap our target region:

>>> all_mRNA_bounds.count_overlaps(cds.merge_overlaps())
  index  |    Chromosome           Start      End     Count
  int64  |    category             int64    int64    uint32
-------  ---  -----------------  -------  -------  --------
      0  |    CAJFCJ010000097.1     2248    53404        10
PyRanges with 1 rows, 4 columns, and 1 index columns.
Contains 1 chromosomes.

AI coding assistant

Nowadays, coding is greatly facilitated by AI coding assistants (ChatGPT, Copilot, etc.). Pyranges provides methods to streamline the use of such tools to generate or modify pyranges1 codes. There are two main functions for this purpose. The first one is export_docs. It generates a text file with the documentation of all pyranges1 functionalities:

>>> pr.assistant.export_docs("pyranges_docs.txt")

The second one is prompt:

>>> pr.assistant.prompt()
'Act as an expert bioinformatician programmer experienced in pyranges1 (complete documentation attached for you to learn). Next, answer my requests for code by first explaining the workflow, followed by oneliner-style code snippets, as concise as possible but elegant, preceded by the text of task as commented code. Ensure you use pyranges1 v1 interface that you find here, rather than the v0, from which you may have seen examples before; v1 renamed many methods. '

This concludes our tutorial. The next pages will delve into pyranges1 functionalities grouped by topic.